Busch Lab

ZMP

rfx2

Ensembl ID:
ENSDARG00000013575
ZFIN ID:
ZDB-GENE-050227-4
Description:
DNA-binding protein RFX2 [Source:UniProtKB/Swiss-Prot;Acc:Q5EAP5]
Human Orthologue:
RFX2
Human Description:
regulatory factor X, 2 (influences HLA class II expression) [Source:HGNC Symbol;Acc:9983]
Mouse Orthologue:
Rfx2
Mouse Description:
regulatory factor X, 2 (influences HLA class II expression) Gene [Source:MGI Symbol;Acc:MGI:106583]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa14019 Nonsense Available for shipment Available now
sa31644 Nonsense Available for shipment Available now
sa21260 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa14019
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 Nonsense 113 734 5 18
ENSDART00000122943 Nonsense 113 738 4 18
ENSDART00000132218 Nonsense 83 189 4 6
ENSDART00000133141 Nonsense 83 234 5 7
ENSDART00000147634 Nonsense 83 170 4 5
Genomic Location (Zv9):
Chromosome 8 (position 20638559)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20068456
GRCz11 8 20100541
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCTTATAAYCCAGAGTCCCAGCTATATGGTCAGGGCAGTGGAAGTGCCTA[T/A]TTCGACTCTCAGGCGGGTGGTGCTCAGGTAACCACAGTCGTCTCTTCTGG
Long Flanking Sequence:
ATCCGCCATTTTGTCATGATCACATGACCTGTCTGCGTCAGTTGCATCACTTCACTCCCATTTCTGAGTTCTCTCGTAAGGCATCATAAGATAGCGTAGAATACATCATATGCACACTTTAGAATTTCACCGGAAGTAGTACGTCATCTGGGTACTTCTCGCATACTGTTTTTTGTATTCTATGATTTTGGACATACTATTCGGCTCGCATACTGTTTTTAGTGTAATGTATAGTATGAACATATGTGATTTCGGACACAGCCAAGGAAAAATGTGTAGAGCTGGTGATCCTCCAGGTACGTGGTTGAGAAACAAATTCACCTGTTTTAAGGTTGTTAAAAAGTTAAAGTCAATAGTTGATTATTTTGAAATGAGTTATTTTGAAAATCGAGACAATAGTTAAAACTAAACACGCCTGTATTTTTATCCTTCTTCAGTCGTGCTGCATACTCTTATAACCCAGAGTCCCAGCTATATGGTCAGGGCAGTGGAAGTGCCTA[T/A]TTCGACTCTCAGGCGGGTGGTGCTCAGGTAACCACAGTCGTCTCTTCTGGTGGAGTGCCCACTCATGGCATGGTGGGAATTGCTATGGATGTGGGTGGCAGTCAGATCATTTCCAGCGGCAGCGCCTACCTGATCCACGGCGGGATGGAAGGTGGCCGCCACCACACCTCTCACTCCTCACGCTCATCATCTGCAATGGTACGTTCCACTGTGCTTAAGTCCTGAACATGGGAGTAACATGGGAGGGGAGTTTGGGGAGCTGTGGTTTAGAAAATGAGCACAGCCTAATAATGCTATATTCCAGATGAGGTGTGACAGGAATGTACAGAGATATGTTTACATGGTCAAAAACAATGACTTATCCCTCAGTTTGCGAAATCTCCCCAAAAAGTTGCGCTTCCAGTTATCACACTAAATGTGTATGCATTGCATCATTATTGCCACTAATATTAAACATTATTGCAGAGTTGGTTTTCCCCTAAATGAAACTTTGTTTATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3649
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 Nonsense 377 734 10 18
ENSDART00000122943 Nonsense 377 738 9 18
ENSDART00000132218 None None 189 None 6
ENSDART00000133141 None None 234 None 7
ENSDART00000147634 None None 170 None 5
Genomic Location (Zv9):
Chromosome 8 (position 20629731)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20059628
GRCz11 8 20091713
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GCTCCTGTCCTCTGCCGGAGTCCATCAGCATGACTGATGTGAAAAAACTA[C/T]AGAGCAGCTACAGGATTCACTGTGAGGTAAATTGTAGTTGTAGGATTTTT
Long Flanking Sequence:
CTAATTACTATTTCATGTGTCAGAGGCTCTTTTATTGTGTTGGAAATGCACAGAACAGCTTTATATTAGACATTGGCTCTGCATCCTGAAGGAAAATCTTTTTCTCTTTCTCTCTTAGTCATATCCTCTGTAATCCCAGTAGTGAATCCTGCATTTAGTCCTGCTGTCGGTATTTCCTGTGTCCAGGTTTAAGCCCTTTCACAAGATGGATGGGATGGGGGACAGTCTGAACAGTGGCTCCCAGCATTTGTCCAGCACCCCTGAGCAGAGCGTGGCGGCCCAGTGTCAGCATCACCAGCAGTACATTGGTAAACCTCCTCTTACAGTCACATCAAAACAGCTGAATGGATGCACAATCACCTTCAGCTCTAAAACTGTGTGTGTGTGTGTCTGTGTGTGTTTTGGCAGATGTGTCTCATGTCCTTCCTCCCTTCCCTTCTCTTGATCTGGGCTCCTGTCCTCTGCCGGAGTCCATCAGCATGACTGATGTGAAAAAACTA[C/T]AGAGCAGCTACAGGATTCACTGTGAGGTAAATTGTAGTTGTAGGATTTTTTTTGTAAATGTAGCCTTCCTAATTACGAGTGCTCCCTGTGGAAGGAAGAGCTTTACAATGTCTTTAGAAGGAAGAAACTCTTTTAAGGAAATTATTAAAGCACACTGGCGGAATTAAGCTTCCTCATGCTGGAAGACATTACATTCCATGTTATTCTATGCCTATTACAATTTTTGAAATGTATCTTTTCAAAATAAATATCAAAGTAAGAATAAATAAAGCATCAAACCAGGGATTCTCAACCGGTGGGCCTCAGCGATCCTGCAGGTGGGCCAAGTGATAGCTTATAAGTAACTCTCAATATTCTACTATAATTTTGGAATTTCATTAATAAATATGCTATATTAAAATGATCAAAGCAATGCACTTTCTCCTGATTGCTTCAAACTTGGTGCAAAAACAACCTCATGATTGCGTCTGCAACTAGTACACGATGGCAGTGCATTCAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31644
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 Nonsense 403 734 11 18
ENSDART00000122943 Nonsense 403 738 10 18
ENSDART00000132218 None None 189 None 6
ENSDART00000133141 None None 234 None 7
ENSDART00000147634 None None 170 None 5
Genomic Location (Zv9):
Chromosome 8 (position 20622040)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20051937
GRCz11 8 20084022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCTGGATGTTGTGATGAACCTGCAATTTCATCTCATAGAGAAGCTGTG[G/A]CAGACCTTTTGGCATTCAACAGCGCCCTCTAGTGACGGAGCCACTACCAT
Long Flanking Sequence:
AAAAAAACTTTTAATACAAAAATAATTTGAACATATTGTCCTGCAGTCTGTCACCTTAAACAGAACCTGAAATGAAGTTGAATTTATATATGTGGCTAGTGTTGTGCAACCATTTAGGCAGTTTCTATAAGAAGGTGGGTTGCTTTGAAGATGCTGCTTCAGAATGAGGAGCGAATGAGTTTTGATGGATGGCCGTATTATGAGTGGGCCAAATTCAAGATGAGCCATCAGGAAAGACAAAAGACACTTCAAATAATGGAGGAACACTCATCTCTCACACTCTATATTCATGAGATCTTCCTACAGCCCCCCAAAACACAGCTTTTGTTCCGGAATCATTTGTAATTTTGTTGTTATTGTGTTATCAGGAGAAACATTTTTCCTGTTTAAATGATTTTAATGCACACAAGAAACTTTGTTATAATAAACCTGATTTCTCTCCTTTAGGCTACTCTGGATGTTGTGATGAACCTGCAATTTCATCTCATAGAGAAGCTGTG[G/A]CAGACCTTTTGGCATTCAACAGCGCCCTCTAGTGACGGAGCCACTACCATACCTAACAGGTGCCATGTCTATACAGTTCATAGTTAAAGTAAAAAGGAACGCAACAATTAAAAAACAAAACTCACGCTCATGGAAAACCTGAAAGCATCTAGGATTTTTTTTAAATAATTTGGTGATCTTAGAAAATAATCAACATTTTAAAATATCATTTTTTTTGGTATGATCTGCTATTAAATATAAGCTACTGTAATGTTCCAAAGTTCAAGGTCATTGATATTGCCAATGTTGCATTTGTTATATTATAGTAATACATATATTATATTATAATATTTTATATTATATTATATTACATTATATTATATTACGTTATATTATATTATGTTATATTATGTTATATTATATTATATGTAAAGCTGTAAAAATATTATTACAACGTAAAATAAAAATTACCAAAAACAATCTAAAAACCAAAAACACTGTCAAAACACACCAGTGCTCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5475
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 Essential Splice Site 680 734 17 18
ENSDART00000122943 Essential Splice Site 680 738 16 18
ENSDART00000132218 None None 189 None 6
ENSDART00000133141 None None 234 None 7
ENSDART00000147634 None None 170 None 5
Genomic Location (Zv9):
Chromosome 8 (position 20612703)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20042600
GRCz11 8 20074685
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGAAAAAANTCTTCTATAAATATATATTAATGTTTTTCNTGTTTATTTTCA[G/A]TTCAGTGACCTCAGTTCATTAATGCCATCCCTCAAGGAGCAAGGTAACCC
Long Flanking Sequence:
ATTGATAACATATACAGTTGAAGTCAGAATTATTAGCCTCCCTTTGTTTTTTTATTTTTTAAATGTTTCCTAAATTATGTTAAACAGAGCAAGGACATTTTCACAGTATGTCTGGTAATATTTTTTTCTTCTGCGGAAAGTCTTATTTGTATTATTTTAGCTAGAATAAAAGAAGTTTTTATTTTTTTTATAAACTATTTTAAGGTCAAAATTATTAGCCCCTTAAAGCTATTTTCCCCGTAAAAACAAACCATCATTATACAATAACTTGCCTAATTACCCTAACCTGCCTAGTTAACCTAATTAACCTAGTTACGCCTTTAAATGCCACTTTAAGCTGTATAGAAGTGTCTTGGAAAATGTCTAGTCAAATATTATTTACTCTCATCATGACAAAGAAAAAATAAATCACTTATTAGATATAATATAACTATTATATTTAGAAATGTGTTGAAAAAATCTTCTATAAATATATATTAATGTTTTTCTGTTTATTTTCA[G/A]TTCAGTGACCTCAGTTCATTAATGCCATCCCTCAAGGAGCAAGGTAACCCATTCAAACCCCAGCCTAAAATATTGCATTGATTTTGAAGTCTCGTCTTCTCTTCTATTAAACCTCTCTCTCTGTTTTCCCGCATAGACACTTCATTCTCAGACGACATGACCAGCGATGGAGACATGTCGAGGATGAGCGAGAGAAGCCTGACTGAACCAGCGGTAAAGAGAGAAAGAATCGAGATCCCTCACTCCCTGCAGGAGATCTAACAGACACAAACGTCATCTCCGTCTTTAGAGTAGGGTCAGCGTGTGTCTCCTTTAGGTTTTCTGCGACTGTGAAGCAAGAATGTGCTGGTTTGGTGGCGTGTGGTTTATTTTTCATGTGCCATAGTCTTCTTTCAGTGCCTTAGATGAGAAAAGAAACACTAGAGCTTTCTCTTTGACCTTCTGTCGTTTTCCTCGGCCGTGCCTCCAACCGCAGGATGAATGTATCGTCTATGAACCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21260
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000029939 None None 734 18 18
ENSDART00000122943 Nonsense 727 738 18 18
ENSDART00000132218 None None 189 None 6
ENSDART00000133141 None None 234 None 7
ENSDART00000147634 None None 170 None 5
Genomic Location (Zv9):
Chromosome 8 (position 20612354)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 20042251
GRCz11 8 20074336
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCGTGTGTCTCCTTTAGGTTTTCTGCGACTGTGAAGCAAGAATGTGCTG[G/A]TTTGGTGGCGTGTGGTTTATTTTTCATGTGCCATAGTCTTCTTTCAGTGC
Long Flanking Sequence:
GTCTTGGAAAATGTCTAGTCAAATATTATTTACTCTCATCATGACAAAGAAAAAATAAATCACTTATTAGATATAATATAACTATTATATTTAGAAATGTGTTGAAAAAATCTTCTATAAATATATATTAATGTTTTTCTGTTTATTTTCAGTTCAGTGACCTCAGTTCATTAATGCCATCCCTCAAGGAGCAAGGTAACCCATTCAAACCCCAGCCTAAAATATTGCATTGATTTTGAAGTCTCGTCTTCTCTTCTATTAAACCTCTCTCTCTGTTTTCCCGCATAGACACTTCATTCTCAGACGACATGACCAGCGATGGAGACATGTCGAGGATGAGCGAGAGAAGCCTGACTGAACCAGCGGTAAAGAGAGAAAGAATCGAGATCCCTCACTCCCTGCAGGAGATCTAACAGACACAAACGTCATCTCCGTCTTTAGAGTAGGGTCAGCGTGTGTCTCCTTTAGGTTTTCTGCGACTGTGAAGCAAGAATGTGCTG[G/A]TTTGGTGGCGTGTGGTTTATTTTTCATGTGCCATAGTCTTCTTTCAGTGCCTTAGATGAGAAAAGAAACACTAGAGCTTTCTCTTTGACCTTCTGTCGTTTTCCTCGGCCGTGCCTCCAACCGCAGGATGAATGTATCGTCTATGAACCTCAGATGTCTAAAGCACCTTTTTAAACGGCAGCCACTTTTATTTTTTCCCTCTCTCAGACGTAGATGCAACCTGCTGACCCCAAAGCCGCCCGTTTTCAGCCTCCACCCAAAACTTGCTGCAACACGAGAAAAGCCTTCAGAAGCATCCGTTTGATGAGAGCTCTGGCCGTATGAGATGCCTAGTCTATACCTCAAAGCATTCGTAGGTTTAATCAATTGACGTCCAGCTTTTATGATGTTTTCTAATGAGATGAGTGGATTTGGAAGCCCCGCGCTGTTGTTGGAAAGCTCTCGGGATGTATATAAACAGATTCCGTTGGTCGTTATTGCTCGAGCAAAGCAGAAATGGT
Associated Phenotype:
Not determined