Busch Lab

ZMP

ikzf1

Ensembl ID:
ENSDARG00000013539
ZFIN ID:
ZDB-GENE-980526-304
Description:
DNA-binding protein Ikaros [Source:RefSeq peptide;Acc:NP_571061]
Human Orthologue:
IKZF1
Human Description:
IKAROS family zinc finger 1 (Ikaros) [Source:HGNC Symbol;Acc:13176]
Mouse Orthologue:
Ikzf1
Mouse Description:
IKAROS family zinc finger 1 Gene [Source:MGI Symbol;Acc:MGI:1342540]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31915 Essential Splice Site Available for shipment Available now
sa11269 Nonsense Available for shipment Available now
sa22256 Nonsense Available for shipment Available now
sa22255 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa31915
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Essential Splice Site None 537 None 9
ENSDART00000042377 Essential Splice Site None 294 None 4
ENSDART00000046079 Essential Splice Site None 392 None 6
ENSDART00000050481 Essential Splice Site None 434 None 7
ENSDART00000079724 Essential Splice Site None 526 None 8
Genomic Location (Zv9):
Chromosome 13 (position 15948378)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15863411
GRCz11 13 15994403
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCAGGGGACAGCTGGAAGAGCTTCATACTGCAAACTCAAGGAATAGCAGG[T/A]AAATCACTCTCGCAGGCTGTTCCAAGTCACAAATTTCAAACATTTAGTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11269
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Nonsense 179 537 6 9
ENSDART00000042377 None None 294 None 4
ENSDART00000046079 Nonsense 76 392 4 6
ENSDART00000050481 Nonsense 76 434 4 7
ENSDART00000079724 Nonsense 168 526 5 8
Genomic Location (Zv9):
Chromosome 13 (position 15919958)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15834991
GRCz11 13 15965983
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCCAGTGCAATCAATGTGGTGCTTCATTCACTCAGAAGGGTAACCTGCTC[C/T]GACACATCAAACTTCACTCTGGCGAGAAACCTTTCAAATGTCACCTGTGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22256
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Nonsense 294 537 8 9
ENSDART00000042377 None None 294 None 4
ENSDART00000046079 None None 392 None 6
ENSDART00000050481 Nonsense 191 434 6 7
ENSDART00000079724 Nonsense 283 526 7 8
Genomic Location (Zv9):
Chromosome 13 (position 15916302)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15831335
GRCz11 13 15962327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTAGACAGGATAGCTAACAATGTAGCTAAGCGTAAGAGCTCTATGCCA[C/T]AGAGGTTTGTGGGTAAGAGTTGAAGTTTGCTTTCATTGTGCAGCAATATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22255
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016430 Nonsense 330 537 9 9
ENSDART00000042377 Nonsense 87 294 4 4
ENSDART00000046079 Nonsense 185 392 6 6
ENSDART00000050481 Nonsense 227 434 7 7
ENSDART00000079724 Nonsense 319 526 8 8
Genomic Location (Zv9):
Chromosome 13 (position 15913086)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 15828119
GRCz11 13 15959111
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGATGCAGCCCCATGTGATTGATCAGGCCATCAACAGTGCAATTAGCTA[T/A]CTGGGTGCAGAGTCCTTGCGGCCTCTGGTTCAGACCTCTCCTGGGTCCGC
Associated Phenotype:
Not determined