Busch Lab

ZMP

hoxb4a

Ensembl ID:
ENSDARG00000013533
ZFIN ID:
ZDB-GENE-990415-105
Description:
Homeobox protein Hox-B4a [Source:UniProtKB/Swiss-Prot;Acc:P22574]
Human Orthologue:
HOXB4
Human Description:
homeobox B4 [Source:HGNC Symbol;Acc:5115]
Mouse Orthologue:
Hoxb4
Mouse Description:
homeobox B4 Gene [Source:MGI Symbol;Acc:MGI:96185]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa997 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa997
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012470 Nonsense 175 246 2 2
Genomic Location (Zv9):
Chromosome 3 (position 24014513)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23592724
GRCz11 3 23723272
KASP Assay ID:
554-0901.1 (used for ordering genotyping assays)
KASP Sequence:
ACGAGGCAGCAAGTCCTGGAATTGGAGAAAGAGTTCCATTACAACCGCTA[T/A]CTGACCCGCAGAAGAAGGGTGGAAATCGCCCATACACTATGCCTATCTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8115
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000012470 Nonsense 207 246 2 2
Genomic Location (Zv9):
Chromosome 3 (position 24014607)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23592818
GRCz11 3 23723366
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATCTGAACGACAAATTAAGATTTGGTTTCAGAACCGGCGCATGAAGTGG[A/T]ARAAGGACCATAAGCTTCCGAACACCAAAATACGCAGTAACTCTGCAAGC
Associated Phenotype:
Not determined