Busch Lab

ZMP

gga3

Ensembl ID:
ENSDARG00000013479
ZFIN ID:
ZDB-GENE-041111-218
Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 3 [Source:RefSeq peptide;Acc:NP
Human Orthologue:
GGA3
Human Description:
golgi-associated, gamma adaptin ear containing, ARF binding protein 3 [Source:HGNC Symbol;Acc:17079]
Mouse Orthologue:
Gga3
Mouse Description:
golgi associated, gamma adaptin ear containing, ARF binding protein 3 Gene [Source:MGI Symbol;Acc:MG

Alleles

There are 7 alleles of this gene:

Allele Name Consequence Status Availability
sa33840 Nonsense Mutation detected in F1 DNA Not yet available
sa45248 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44634 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33841 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa2325 Nonsense F2 line generated Not yet available
sa20678 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa33840
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Nonsense 38 699 2 17
ENSDART00000121692 Nonsense 38 691 2 18
ENSDART00000137144 Nonsense 41 702 2 17
Genomic Location (Zv9):
Chromosome 6 (position 18668557)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22859993
GRCz11 6 19331314
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGACAAGAGGAGTGGGAGTACATCATTGGGTTCTGTGATCAAATCAAT[A/T]AGGAACTTGAGGGGTATGCTTACCTTTCCTAAGTGGTCGTCTTGAGCATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa45248
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Essential Splice Site 67 699 3 17
ENSDART00000121692 Essential Splice Site 67 691 3 18
ENSDART00000137144 Essential Splice Site 70 702 3 17
Genomic Location (Zv9):
Chromosome 6 (position 18668727)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22859823
GRCz11 6 19331144
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACATAAAATCCAGTCACCACAAGAATGGGAGTCATTACAAGCACTAACGG[T/G]GAGTTCATCTGATGCCACCAATGAATTTTAGCAAAACCTGTATTTTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44634
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Essential Splice Site 100 699 4 17
ENSDART00000121692 Essential Splice Site 100 691 4 18
ENSDART00000137144 Essential Splice Site 103 702 4 17
Genomic Location (Zv9):
Chromosome 6 (position 18668912)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22859638
GRCz11 6 19330959
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGAAAATTTCGATTTTTAAATGAACTCATAAAATTAGTTTCACCTAAGG[T/G]AAGTTAAAGGATAATTACATAATTTAAAGTTGTGCTGTCTATTTACTGCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33841
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Essential Splice Site 141 699 5 17
ENSDART00000121692 Essential Splice Site 141 691 5 18
ENSDART00000137144 Essential Splice Site 144 702 5 17
Genomic Location (Zv9):
Chromosome 6 (position 18669168)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22859382
GRCz11 6 19330703
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCAGATGAGGCAAAAATCGCAGAAGCCTATCACATGCTAAAGAAGCAAG[G/A]TTGTTTCATGACAAACATAAACACTGATGTGTAAAAGATCTCTCCTACTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2325
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Nonsense 443 699 13 17
ENSDART00000121692 Nonsense 443 691 13 18
ENSDART00000137144 Nonsense 446 702 13 17
Genomic Location (Zv9):
Chromosome 6 (position 18674441)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22854109
GRCz11 6 19325430
KASP Assay ID:
554-3358.1 (used for ordering genotyping assays)
KASP Sequence:
ATAAYAGATTTCAAAWCCAGTGACTGACTTCCTCTGCAGCTCTACTMCCT[T/G]AAATCCTCCTAACTCWGCAGCACCACCTACATCTAAAACTACCTCRATMA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa20678
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Essential Splice Site 570 699 None 17
ENSDART00000121692 Essential Splice Site 562 691 None 18
ENSDART00000137144 Essential Splice Site 573 702 None 17
Genomic Location (Zv9):
Chromosome 6 (position 18675167)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22853383
GRCz11 6 19324704
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACATCTCCCTAACCAGCGTCTTTGTCCCGCTGGAGGCCATTAAACCAAG[T/A]AAGTCCAATAATAAATGTGGATGCTGTTGGTAGAAAGGATGCTGTATTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7036
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102986 Essential Splice Site 626 699 15 17
ENSDART00000121692 Essential Splice Site 618 691 16 18
ENSDART00000137144 Essential Splice Site 629 702 15 17
Genomic Location (Zv9):
Chromosome 6 (position 18679265)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 22849285
GRCz11 6 19320606
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGCACCACTGTTAGTCAGGAATGTAATGCTACAGGCGGCTGTGCCAAAGG[T/G]GAGGGCAAAAMACTTTACYATGCTCTTTTTTTTTTTTTTTTTTTTTTACA
Associated Phenotype:
Not determined