Busch Lab

ZMP

zgc:103517

Ensembl ID:
ENSDARG00000013476
ZFIN ID:
ZDB-GENE-041114-28
Description:
hypothetical protein LOC492469 [Source:RefSeq peptide;Acc:NP_001007342]
Human Orthologue:
C9orf100
Human Description:
chromosome 9 open reading frame 100 [Source:HGNC Symbol;Acc:25909]
Mouse Orthologue:
E130306D19Rik
Mouse Description:
RIKEN cDNA E130306D19 gene Gene [Source:MGI Symbol;Acc:MGI:3036286]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa33420 Nonsense Mutation detected in F1 DNA Not yet available
sa9083 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26252
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027756 Essential Splice Site 50 427 2 12
ENSDART00000127150 Essential Splice Site 50 426 2 12

The following transcripts of ENSDARG00000013476 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11533803)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12470430
GRCz11 4 12469279
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATCCAGAGTGAGCAGAGATACTGTCAACAGCTGGAACTGGTGGTCACGG[T/G]TCGTCTCTCTCTCTACACACACACACACACACACACACACACATACACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33420
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027756 Nonsense 101 427 4 12
ENSDART00000127150 Nonsense 101 426 4 12

The following transcripts of ENSDARG00000013476 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11518850)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12455477
GRCz11 4 12454326
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTGCTCATCTAGAAATGGGGAGGTTTGGCATTGGTTTCGAGGAGTTCTG[C/A]ACTCATCTGCAGTTGTACAACACATACATTGACAACATCCAAACGGCTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9083
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027756 Nonsense 371 427 10 12
ENSDART00000127150 Nonsense 371 426 10 12

The following transcripts of ENSDARG00000013476 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 4 (position 11481730)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 12418357
GRCz11 4 12417206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CMATCAGATCAGACGCAGATGACCAGAGCTCAACAGAGAGCCAGAACACA[C/T]GAGGAACTAAAAGAGCCATGGTCAGCTCTTTCMCARTTAACRTCTGAACT
Associated Phenotype:
Not determined