Busch Lab

ZMP

supt7l

Ensembl ID:
ENSDARG00000013461
ZFIN ID:
ZDB-GENE-050227-17
Description:
STAGA complex 65 subunit gamma [Source:RefSeq peptide;Acc:NP_001013310]
Human Orthologue:
SUPT7L
Human Description:
suppressor of Ty 7 (S. cerevisiae)-like [Source:HGNC Symbol;Acc:30632]
Mouse Orthologue:
Supt7l
Mouse Description:
suppressor of Ty 7 (S. cerevisiae)-like Gene [Source:MGI Symbol;Acc:MGI:1919445]

Alleles

There is 1 allele of this gene:

Allele Name Consequence Status Availability
sa10427 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa10427
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000010362 Essential Splice Site None 414 None 5
ENSDART00000127200 Essential Splice Site None 278 None 6
Genomic Location (Zv9):
Chromosome 17 (position 41038056)
Other Location(s):
Assembly Chromosome Position
GRCz10 17 40923684
GRCz11 17 40878999
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGGRTTRTTTTACTAATCTTSGCCTTTATGMTCGTCTGTTTATGAAAGG[T/A]AATCCATACGATTCTTATATGARACCCTGGGTAGTAACGCTGTGCAGTAT
Associated Phenotype:
Not determined