Busch Lab

ZMP

si:dkey-15f17.9

Ensembl ID:
ENSDARG00000013453
ZFIN ID:
ZDB-GENE-090313-193
Description:
Putative ATP-dependent RNA helicase TDRD9 [Source:UniProtKB/Swiss-Prot;Acc:B8A4F4]
Human Orthologue:
TDRD9
Human Description:
tudor domain containing 9 [Source:HGNC Symbol;Acc:20122]
Mouse Orthologue:
Tdrd9
Mouse Description:
tudor domain containing 9 Gene [Source:MGI Symbol;Acc:MGI:1921941]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa2676 Nonsense F2 line generated Not yet available
sa17024 Essential Splice Site Available for shipment Available now
sa22335 Nonsense Available for shipment Available now
sa38952 Nonsense Mutation detected in F1 DNA Not yet available
sa35527 Splice Site, Nonsense Available for shipment Available now
sa4512 Nonsense F2 line generated Not yet available

Mutation Details

Allele Name:
sa2676
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 84 1342 3 35
ENSDART00000124958 Nonsense 84 1344 3 35
Genomic Location (Zv9):
Chromosome 13 (position 31628674)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31274622
GRCz11 13 31405072
KASP Assay ID:
554-2480.1 (used for ordering genotyping assays)
KASP Sequence:
AACCTTTGATTTATAGGTCCAGGAACAAGCCCTCCTTCACTGGCCAGTTA[T/A]GAGTATCCAATTCTACCAATTACTAAGAACAGACAAGAGGTACTGTACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17024
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Essential Splice Site 171 1342 4 35
ENSDART00000124958 Essential Splice Site 171 1344 4 35
Genomic Location (Zv9):
Chromosome 13 (position 31629067)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31275015
GRCz11 13 31405465
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGGCACGTGAGCGCAAATGTACTCTGGGAAGCTTGGTGGGGTATCAGG[T/A]GTGAGATGCATGGCATACAATCTCTTTTCCATAACAGTATGAAAATAATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22335
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 495 1342 14 35
ENSDART00000124958 Nonsense 497 1344 14 35
Genomic Location (Zv9):
Chromosome 13 (position 31633014)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31278962
GRCz11 13 31409412
KASP Assay ID:
2260-6604.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGTGTGTGTGTGATTTGAATTGCAGCGGTCACCGTTGGCCAGTACCTTGT[T/A]GAAGGTAAAGTTGTTGGATATGGGGGATCCTCGCTCGGTTCTCTCCACAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38952
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 746 1342 22 35
ENSDART00000124958 Nonsense 748 1344 22 35
Genomic Location (Zv9):
Chromosome 13 (position 31637594)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31283542
GRCz11 13 31413992
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCCTTTCTCTCTCAGATTCGGAATTTGCCTCCGTTTGCATTCCTGTGCTA[T/A]AAGCAGCTGCAGTCACTGTTTCGTCAATGTGGACAGGTCAAGTCAATCGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Splice Site, Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Splice Site, Nonsense 863 1342 24 35
ENSDART00000124958 Splice Site, Nonsense 865 1344 24 35
Genomic Location (Zv9):
Chromosome 13 (position 31638247)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31284195
GRCz11 13 31414645
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAATCCCGAGAAACTTCCAACCAGCCGAGATTTCGTCATCAACATTACT[G/T]AGGTGAAAATACTACACATGAAAGTCCTCTCAAATAGGCTTAACCACATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa4512
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019202 Nonsense 1222 1342 32 35
ENSDART00000124958 Nonsense 1224 1344 32 35
Genomic Location (Zv9):
Chromosome 13 (position 31644902)
Other Location(s):
Assembly Chromosome Position
GRCz10 13 31290850
GRCz11 13 31421300
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACCTGCTTTACTGGAGCTCTGTGTGGACTGGGCTGGAACTCTGTTTCC[C/T]AAGAGGCAGTGCTTCCTGAACATGACATTGAGATTGCATTTGACGTCAAG
Associated Phenotype:
Not determined