Busch Lab

ZMP

sycp3l

Ensembl ID:
ENSDARG00000013438
ZFIN ID:
ZDB-GENE-040910-2
Description:
synaptonemal complex protein 3 [Source:RefSeq peptide;Acc:NP_001035440]
Human Orthologue:
SYCP3
Human Description:
synaptonemal complex protein 3 [Source:HGNC Symbol;Acc:18130]
Mouse Orthologues:
1700013H16Rik, 3830403N18Rik, AC130834.1, AC135805.1, AC142269.1, AC145516.1, AC145586.1, AC145601.1, AC147255.1, AC147716.1, AC147998.1, AC175033.1, AC175494.1, AC182251.1, AC182580.1, AC182761.1, AC183902.1, AC192778.1, AC192923.1, Gm1140, Gm14692, Gm773, Sycp3, Xlr, Xlr3a, Xlr3b, Xlr3c, Xlr4a, Xlr4b, Xlr4c, Xlr5a, Xlr5b, Xlr5c
Mouse Descriptions:
LOC380994 protein [Source:UniProtKB/TrEMBL;Acc:Q4KL07]
LOC380994 protein [Source:UniProtKB/TrEMBL;Acc:Q4KL07]
LOC380994 protein [Source:UniProtKB/TrEMBL;Acc:Q4KL07]
LOC380994 protein [Source:UniProtKB/TrEMBL;Acc:Q4KL07]
LOC380994 protein [Source:UniProtKB/TrEMBL;Acc:Q4KL07]
LOC380994 protein [Source:UniProtKB/TrEMBL;Acc:Q4KL07]
RIKEN cDNA 1700013H16 gene Gene [Source:MGI Symbol;Acc:MGI:1922764]
RIKEN cDNA 3830403N18 gene Gene [Source:MGI Symbol;Acc:MGI:1917941]
Similar to Sycp3 like Y-linked [Source:UniProtKB/TrEMBL;Acc:Q497M4]
X-linked lymphocyte-regulated 3A Gene [Source:MGI Symbol;Acc:MGI:109506]
X-linked lymphocyte-regulated 3B Gene [Source:MGI Symbol;Acc:MGI:109505]
X-linked lymphocyte-regulated 3C Gene [Source:MGI Symbol;Acc:MGI:3047103]
X-linked lymphocyte-regulated 4A Gene [Source:MGI Symbol;Acc:MGI:3574098]
X-linked lymphocyte-regulated 4B Gene [Source:MGI Symbol;Acc:MGI:1350975]
X-linked lymphocyte-regulated 4C Gene [Source:MGI Symbol;Acc:MGI:3574099]
X-linked lymphocyte-regulated 5A Gene [Source:MGI Symbol;Acc:MGI:3574108]
X-linked lymphocyte-regulated 5B Gene [Source:MGI Symbol;Acc:MGI:3574109]
X-linked lymphocyte-regulated 5C Gene [Source:MGI Symbol;Acc:MGI:1350981]
X-linked lymphocyte-regulated complex Gene [Source:MGI Symbol;Acc:MGI:98976]
predicted gene 1140 Gene [Source:MGI Symbol;Acc:MGI:2685986]
predicted gene 14692 Gene [Source:MGI Symbol;Acc:MGI:3713084]
predicted gene 773 Gene [Source:MGI Symbol;Acc:MGI:2685619]
similar to Sycp3 like Y-linked (LOC380994), mRNA [Source:RefSeq DNA;Acc:NM_001037748]
synaptonemal complex protein 3 Gene [Source:MGI Symbol;Acc:MGI:109542]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32527 Nonsense Available for shipment Available now
sa44282 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32527
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021340 Nonsense 167 240 7 9
ENSDART00000137930 None None 145 None 5
Genomic Location (Zv9):
Chromosome 25 (position 20069278)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19481255
GRCz11 25 19579206
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAATTTGTTTCCACAGAATTTGTTTCGCCAGCAACTGAAGCTTTTCCAG[C/T]AGGCAAGGGTTGTGCAAAAGCAAAAGATAAAAACCATCAATGACCTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44282
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000021340 Essential Splice Site 188 240 7 9
ENSDART00000137930 None None 145 None 5
Genomic Location (Zv9):
Chromosome 25 (position 20069211)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 19481188
GRCz11 25 19579139
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAAGCAAAAGATAAAAACCATCAATGACCTGCATGAGCAGTTCGTCAAGG[T/A]CATTAGCACTTTATTTGTGTCAAATTGAACCAAGTGCTTTGATTTTTTTG
Associated Phenotype:
Not determined