Busch Lab

ZMP

hira

Ensembl ID:
ENSDARG00000013434
ZFIN ID:
ZDB-GENE-030131-6296
Description:
Novel protein similar to vertebrate HIR histone cell cycle regulation defective homolog A (S. cerevi
Human Orthologue:
HIRA
Human Description:
HIR histone cell cycle regulation defective homolog A (S. cerevisiae) [Source:HGNC Symbol;Acc:4916]
Mouse Orthologue:
Hira
Mouse Description:
histone cell cycle regulation defective homolog A (S. cerevisiae) Gene [Source:MGI Symbol;Acc:MGI:99

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40382 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33557 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40382
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006215 Essential Splice Site 371 993 11 26
ENSDART00000132164 Essential Splice Site 371 1010 11 25

The following transcripts of ENSDARG00000013434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 19652146)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17552119
GRCz11 5 18056115
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGACTTCTCGCAGGATGAACTGGGAGACCCCTTGAATGAAGAGGAAAAG[G/A]TGGAGAAAAAGCACACAAACCAGAGTTGAACACTTAGAGTTAGTGTAATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33557
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006215 Nonsense 562 993 15 26
ENSDART00000132164 Nonsense 562 1010 15 25

The following transcripts of ENSDARG00000013434 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 5 (position 19645313)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 17558952
GRCz11 5 18062948
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCTGCTGACTTCTGCCTCCAAAATCGAGCCCATGAAAGCACTAGATTCA[C/T]GATTTACTGAAAGGTCAAAAGCCACACCAGGGGTCACTAGCGTACCCATC
Associated Phenotype:
Not determined