Busch Lab

ZMP

ARHGAP9

Ensembl ID:
ENSDARG00000013390
Description:
Rho GTPase activating protein 9 [Source:HGNC Symbol;Acc:14130]
Human Orthologue:
ARHGAP9
Human Description:
Rho GTPase activating protein 9 [Source:HGNC Symbol;Acc:14130]
Mouse Orthologue:
Arhgap9
Mouse Description:
Rho GTPase activating protein 9 Gene [Source:MGI Symbol;Acc:MGI:2143764]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa30881 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa30881
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050140 Essential Splice Site 370 509 14 17
Genomic Location (Zv9):
Chromosome 6 (position 58947391)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59044136
GRCz11 6 59038367
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGTGTGTGTGTGTGTGTGTGTAACACAGACTTTGTGTGTTTCCTCC[A/T]GAGCGTCTGGATCTAGATGACCCGCAGTGGGAGGATATTCACGTGATCAC
Long Flanking Sequence:
TTCATAATCTATTTGCTGACTTCATGATCTGCTGATTTCATAATCTATTTGCTGACTTCATGATCTGCTGATTTCATAATCTATTTGCGGACTTCATGATCTGCTAATTTTATGATCTATTTGCTGATTTTTTATAATCTGCTGATTTCATGATTTAATTGACGATTTCATGATCTAATTGCTGATTTAATGATCTGCTGATTTCATGATTTAATTGACGATTTCATGATTTAATTGCTGATTTTATGATCATGCTGACACCATGATCTCCTGATTTAATGATCTGCTGATTTATTTGCTGATTTGATGATCTGCTGATTCAAAGATCTATCTGCTGATCTGCATCTGCTTATGTGAACAATCTGCTGATTTCATGATCTGCTGATTTGACTGATCTGCTGATGTGTGTGCTCACCTTCTCCTGTTAAGCGTTGTCTCCTTCTGCAGATGTTCTGGTGTGTGTGTGTGTGTGTGTAACACAGACTTTGTGTGTTTCCTCC[A/T]GAGCGTCTGGATCTAGATGACCCGCAGTGGGAGGATATTCACGTGATCACCGGAGCGCTGAAGCTGTTCTTCAGAGAGCTGCCCGAACCCCTCGTGCCCTTCAGCGCATTCCACGACTTTGTAGACAGCATCAGTGAGTGTTAGCCTGAGTAACACACACACACACACAGCACCATACATACACATGCATACTGTAGACAAAAACATTCACGCACAAACATACACAAAAAAATACACATGCATACGCACAAACACATGCACACAAATTGTACACAAGCATAATATACACATGCACATATACAGTGCACACACACAAAGCATACATGTACACATGCATGCACACACACACACACACACACATGCATACTGTAGACAAAAACACAGACACATATATGCAAACACAGTGCACAAACAAACTCAAACACACGCAAACAAACACATAGGCACATTTATTGCAATCCAAACACAAACTCAAACACAGGCATGTACTAACAAACAAA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26856
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000050140 Nonsense 378 509 14 17
Genomic Location (Zv9):
Chromosome 6 (position 58947416)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 59044161
GRCz11 6 59038392
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AACACAGACTTTGTGTGTTTCCTCCAGAGCGTCTGGATCTAGATGACCCG[C/T]AGTGGGAGGATATTCACGTGATCACCGGAGCGCTGAAGCTGTTCTTCAGA
Long Flanking Sequence:
GATCTGCTGATTTCATAATCTATTTGCTGACTTCATGATCTGCTGATTTCATAATCTATTTGCGGACTTCATGATCTGCTAATTTTATGATCTATTTGCTGATTTTTTATAATCTGCTGATTTCATGATTTAATTGACGATTTCATGATCTAATTGCTGATTTAATGATCTGCTGATTTCATGATTTAATTGACGATTTCATGATTTAATTGCTGATTTTATGATCATGCTGACACCATGATCTCCTGATTTAATGATCTGCTGATTTATTTGCTGATTTGATGATCTGCTGATTCAAAGATCTATCTGCTGATCTGCATCTGCTTATGTGAACAATCTGCTGATTTCATGATCTGCTGATTTGACTGATCTGCTGATGTGTGTGCTCACCTTCTCCTGTTAAGCGTTGTCTCCTTCTGCAGATGTTCTGGTGTGTGTGTGTGTGTGTGTAACACAGACTTTGTGTGTTTCCTCCAGAGCGTCTGGATCTAGATGACCCG[C/T]AGTGGGAGGATATTCACGTGATCACCGGAGCGCTGAAGCTGTTCTTCAGAGAGCTGCCCGAACCCCTCGTGCCCTTCAGCGCATTCCACGACTTTGTAGACAGCATCAGTGAGTGTTAGCCTGAGTAACACACACACACACACAGCACCATACATACACATGCATACTGTAGACAAAAACATTCACGCACAAACATACACAAAAAAATACACATGCATACGCACAAACACATGCACACAAATTGTACACAAGCATAATATACACATGCACATATACAGTGCACACACACAAAGCATACATGTACACATGCATGCACACACACACACACACACACATGCATACTGTAGACAAAAACACAGACACATATATGCAAACACAGTGCACAAACAAACTCAAACACACGCAAACAAACACATAGGCACATTTATTGCAATCCAAACACAAACTCAAACACAGGCATGTACTAACAAACAAACAAACACATAGATACACACACACAC
Associated Phenotype:
Not determined