Busch Lab

ZMP

anxa6

Ensembl ID:
ENSDARG00000013335
ZFIN IDs:
ZDB-GENE-030707-3, ZDB-GENE-030707-3, ZDB-GENE-030707-3
Description:
annexin A6 [Source:RefSeq peptide;Acc:NP_001002038]
Human Orthologue:
ANXA6
Human Description:
annexin A6 [Source:HGNC Symbol;Acc:544]
Mouse Orthologue:
Anxa6
Mouse Description:
annexin A6 Gene [Source:MGI Symbol;Acc:MGI:88255]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa17582 Essential Splice Site Available for shipment Available now
sa32005 Nonsense Available for shipment Available now
sa35765 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4580
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Nonsense 81 393 5 16
ENSDART00000105346 Nonsense 81 568 5 21
ENSDART00000126260 None None 202 None 8
Genomic Location (Zv9):
Chromosome 14 (position 51566576)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50319344
GRCz11 14 49307101
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTGTGTGTGTGTGTGTGTGTGTGTGTGTAATGTGATTATAGGAGCTGTA[T/A]GAGGCAGGAGAGGCACAGTGGGGCACAGACGAGGCTAAATTCATCATGCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7748
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Nonsense 116 393 6 16
ENSDART00000105346 Nonsense 116 568 6 21
ENSDART00000126260 None None 202 None 8
Genomic Location (Zv9):
Chromosome 14 (position 51572545)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50325313
GRCz11 14 49313070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CNNAGCGAGTATATCATTGTTTGTTTTTCCCAGTGTTTGATGAATATCAG[A/T]AAATTGCAGAGAAATCCATTGAGGACAGTATTAAAAGTGAGCTGTCCGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17582
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Essential Splice Site 142 393 6 16
ENSDART00000105346 Essential Splice Site 142 568 6 21
ENSDART00000126260 None None 202 None 8
Genomic Location (Zv9):
Chromosome 14 (position 51572625)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50325393
GRCz11 14 49313150
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTAAAAGTGAGCTGTCCGGAGACTTTGAGAGACTCATGCTGGCTGTMGG[T/C]AAGCTTCRGCAKATCGAGATCAGTTMCTGAAACTCAYATYTGCCTTTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32005
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Nonsense 342 393 13 16
ENSDART00000105346 Nonsense 342 568 13 21
ENSDART00000126260 Nonsense 167 202 6 8
Genomic Location (Zv9):
Chromosome 14 (position 51603548)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50356316
GRCz11 14 49344073
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTGGGTCTCATGATGACACCGGCCGACTTTGACGCCAAGATGATGAAG[A/T]AAGCCATGGAGGTATTTACAGGAAAATTGCAGTGATACAAATATGAACAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35765
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006073 Essential Splice Site 376 393 14 16
ENSDART00000105346 Essential Splice Site 376 568 14 21
ENSDART00000126260 Essential Splice Site 201 202 7 8
Genomic Location (Zv9):
Chromosome 14 (position 51605245)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 50358013
GRCz11 14 49345770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTAGAAGCAATCAGGAGATTCAGGAGATGTGCTCGGCCTATCAGAACGG[T/G]AAATATATCGCACAGAGTGCAGCAGGGGGCGCTGTTCATCTGGGAAAAAC
Associated Phenotype:
Not determined