Busch Lab

ZMP

tars

Ensembl ID:
ENSDARG00000013250
ZFIN ID:
ZDB-GENE-041010-218
Description:
threonyl-tRNA synthetase, cytoplasmic isoform 1 [Source:RefSeq peptide;Acc:NP_001116258]
Human Orthologue:
TARS
Human Description:
threonyl-tRNA synthetase [Source:HGNC Symbol;Acc:11572]
Mouse Orthologue:
Tars
Mouse Description:
threonyl-tRNA synthetase Gene [Source:MGI Symbol;Acc:MGI:106314]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa9871 Essential Splice Site Available for shipment Available now
sa31471 Essential Splice Site Available for shipment Available now
sa17576 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa9871
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Essential Splice Site 187 718 5 19
ENSDART00000051141 Essential Splice Site 187 624 5 18
Genomic Location (Zv9):
Chromosome 5 (position 45970954)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43752219
GRCz11 5 44352372
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGACCACCCATCGAAAAKGRCTTTTACTATGATATGTATCTTGATAATGA[G/A]TAAGTCAAACACATTTTCAGTTCATTTTTTAATGTTTATTTATTTTTTGA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26557
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Nonsense 325 718 10 19
ENSDART00000051141 None None 624 None 18
Genomic Location (Zv9):
Chromosome 5 (position 45976718)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43757983
GRCz11 5 44358136
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTTAATGTCTACCCTTGCTCTCTTTCTTTCCTTTTGTCTTTCCAGGAG[C/T]AAGATTTGTTTTTCTTCCACGACCTGAGCCCGGGTAGCTGTTTCTTTCTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31471
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Essential Splice Site 572 718 15 19
ENSDART00000051141 Essential Splice Site 478 624 14 18
Genomic Location (Zv9):
Chromosome 5 (position 45984756)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43766021
GRCz11 5 44366174
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTCAGCTGGACTTCCAGCTGCCCATTCGCTTCAATCTCACATTTGTAAG[G/T]TGTGTTTACTCAGTGAAACATTACAGCCTGTGTACAATAATGAGTGTAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17576
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034523 Nonsense 610 718 17 19
ENSDART00000051141 Nonsense 516 624 16 18
Genomic Location (Zv9):
Chromosome 5 (position 45985146)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 43766411
GRCz11 5 44366564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TATGTTCGCATAAAAYATAYGCCTGATTTTATTTCCCACAGGCCACTTTG[G/A]TTGTCCCCGCGTCAGGTGATGGTGGTTCCTATTGGACCCACCTGTGAKGA
Associated Phenotype:
Not determined