Busch Lab

ZMP

zeb1

Ensembl ID:
ENSDARG00000013207
ZFIN ID:
ZDB-GENE-010621-1
Description:
zinc finger E-box-binding homeobox 1 [Source:RefSeq peptide;Acc:NP_571784]
Human Orthologue:
ZEB1
Human Description:
zinc finger E-box binding homeobox 1 [Source:HGNC Symbol;Acc:11642]
Mouse Orthologue:
Zeb1
Mouse Description:
zinc finger E-box binding homeobox 1 Gene [Source:MGI Symbol;Acc:MGI:1344313]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa2635 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27957
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047724 Essential Splice Site 19 1078 1 8
Genomic Location (Zv9):
Chromosome 12 (position 28422673)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26760282
GRCz11 12 26851642
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGCCCCAGGTGTAAGCGCAGAAAGCAGGCGAACCCGAGGAGGACAAACG[G/A]TGAGTAAAAACCCTTCGCTTTGATTGGCGACGGCTGATTTCATTCAACTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2635
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000047724 Nonsense 573 1078 6 8
Genomic Location (Zv9):
Chromosome 12 (position 28329873)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 26667482
GRCz11 12 26758842
KASP Assay ID:
554-2726.1 (used for ordering genotyping assays)
KASP Sequence:
GCAAAGATATCGGAGTCTGTCAGTCTTCCAGCAGAGGTGGTGAAAAAGTG[G/A]TTTGAGAAGATGCAGCTGGGACAGATCTCCATRGACCCTTCTTCACCTMA
Associated Phenotype:
Not determined