Busch Lab

ZMP

si:dkey-147f23.1

Ensembl ID:
ENSDARG00000013177
ZFIN ID:
ZDB-GENE-081104-49
Description:
LOC100004228 protein [Source:UniProtKB/TrEMBL;Acc:Q1ECW0]
Human Orthologues:
SLC27A2, SLC27A5
Human Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 [Source:HGNC Symbol;Acc:10996]
solute carrier family 27 (fatty acid transporter), member 5 [Source:HGNC Symbol;Acc:10999]
Mouse Orthologues:
Slc27a2, Slc27a5
Mouse Descriptions:
solute carrier family 27 (fatty acid transporter), member 2 Gene [Source:MGI Symbol;Acc:MGI:1347099]
solute carrier family 27 (fatty acid transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1347100]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa39489 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa38111 Nonsense Available for shipment Available now
sa6003 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5110
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Essential Splice Site 228 618 2 10
ENSDART00000145015 Essential Splice Site 226 415 2 6
Genomic Location (Zv9):
Chromosome 25 (position 33286927)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31897329
GRCz11 25 32308286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGGCCTTCAACACCCCAGCGGCCTACATCTACACTTCAGGAACCACCGG[T/A]AACGCCCGTCTCTTACACAATTNTTTTTTCTGTGTTGTTCTCCTGGCTTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39489
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Essential Splice Site 281 618 3 10
ENSDART00000145015 Essential Splice Site 279 415 3 6
Genomic Location (Zv9):
Chromosome 25 (position 33284478)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31894880
GRCz11 25 32305837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCACAGCTCTGGCTTTGGCCTCGGGTTCGGAGGTTCTGTTGAACGAGG[T/A]ATTTCATTGACTTCTTTTACTGTTAGTTTTGTTTAGTTTTCTGTACATAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa38111
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Nonsense 412 618 6 10
ENSDART00000145015 Nonsense 410 415 6 6
Genomic Location (Zv9):
Chromosome 25 (position 33279928)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31890330
GRCz11 25 32301287
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTTTGATCATGAGAAAGAGGAGCCCGTCAGAAACGCTGATGGATTTTG[T/A]ATTGAAGTTGCAAAGGGCAAGTAATATGGAGCCAATAATGTGACAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6003
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000086334 Essential Splice Site 484 618 7 10
ENSDART00000145015 None None 415 None 6
Genomic Location (Zv9):
Chromosome 25 (position 33276258)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 31886660
GRCz11 25 32297617
KASP Assay ID:
554-3880.1 (used for ordering genotyping assays)
KASP Sequence:
ACCGAGAAAACTTCATCTACTTCCAGGATCGGGTGGGCGACACTTTTAGG[T/A]GAATCAATCACATGAATACAGTGGGTTTACATNNNNNGGCTTCTCCATTC
Associated Phenotype:
Not determined