Busch Lab

ZMP

dhx16

Ensembl ID:
ENSDARG00000013150
ZFIN ID:
ZDB-GENE-030131-8589
Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 16 [Source:RefSeq peptide;Acc:NP_956318]
Human Orthologue:
DHX16
Human Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 16 [Source:HGNC Symbol;Acc:2739]
Mouse Orthologue:
Dhx16
Mouse Description:
DEAH (Asp-Glu-Ala-His) box polypeptide 16 Gene [Source:MGI Symbol;Acc:MGI:1916442]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa35958 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39062 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa42595 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa35958
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Essential Splice Site None 1054 1 21
Genomic Location (Zv9):
Chromosome 15 (position 34229739)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35075515
GRCz11 15 34933484
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGCATACATGTTGTTGTAAGAGAAAGCGTGTGGAGAGACAACTAAACG[T/A]AAGTTTAGCGTTTCCAGTGTTAATGTTTAAGTTTGTGAACCAGTATACTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39062
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Essential Splice Site 66 1054 2 21
Genomic Location (Zv9):
Chromosome 15 (position 34226780)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35072556
GRCz11 15 34930525
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGACATTGATCAAAGAATCACAGCGTTTGCACATGAGTTGTACGACAAGG[T/A]ATGTTTTTTAAGGTCAATACACAGAATGTTAATGTAATACTTGAATTTAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa42595
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Nonsense 364 1054 7 21
Genomic Location (Zv9):
Chromosome 15 (position 34220975)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35066751
GRCz11 15 34924720
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGGCCAGACAAGAGCGCGAACGGCGGATCAAGGAGGAGCAGGAGAGATAC[C/T]AGCTCATTTTAGAGGAAGAGGAGATGATCACCTTCGTCAGCACCGCAATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28505
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Nonsense 710 1054 14 21
Genomic Location (Zv9):
Chromosome 15 (position 34209699)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35055475
GRCz11 15 34913444
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTCTCACCATCGACGGCATCATCTATGTGATCGATCCGGGATTTTGCAAG[C/T]AAAAGAGCTACAATGCAAAAACAGGAATGGAGTCTCTCATTGTCACTCCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2834
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006288 Nonsense 972 1054 20 21
Genomic Location (Zv9):
Chromosome 15 (position 34198083)
Other Location(s):
Assembly Chromosome Position
GRCz10 15 35043859
GRCz11 15 34901828
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTAACTGCGGGATATTTCTACCATACAGCACGGTTGAGTAAAGGGGGATA[T/G]AAAACGGTAAAACACCAGCAGACAGTTTAYGTCCATCCCAACAGCTCACT
Associated Phenotype:
Not determined