Busch Lab

ZMP

ywhaba

Ensembl ID:
ENSDARG00000013078
ZFIN ID:
ZDB-GENE-030131-6583
Description:
14-3-3 protein beta/alpha-A [Source:UniProtKB/Swiss-Prot;Acc:Q5PRD0]
Human Orthologues:
YWHAB, YWHAZ
Human Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide [Source:HGN
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide [Source:HGN
Mouse Orthologues:
Ywhab, Ywhaz
Mouse Descriptions:
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, beta polypeptide Gene [Sourc
tyrosine 3-monooxygenase/tryptophan 5-monooxygenase activation protein, zeta polypeptide Gene [Sourc

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa16229 Essential Splice Site Available for shipment Available now
sa11447 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa16229
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025940 Essential Splice Site None 244 1 6
ENSDART00000143458 None None 226 None 5
Genomic Location (Zv9):
Chromosome 6 (position 52163531)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52212713
GRCz11 6 52212712
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TACTCCCATCGTTAACAGAYACAAATCAGGACTCGAAATATATTCCAATG[T/C]GAGTTACACTACCCGCGAAGGCMGCTCGTGTGATAGTATGAATATTAGGG
Long Flanking Sequence:
TTTTTATGTGTTAGAAATGTTATAAGGCCTTCATAGAACGAGACAAATATTTACATACATAACCCATACCTAATATATAATAATAATAAACGAGAAATGTCAGTTATCTTCACATAATCAGTTTTATCCACTGAGTTTTCTCAGTATGTGTTGTATATATGAGCATTTGAGCTGCATTTGAGATTTCCAAACCTGATTCTTCTCACTCGAGCTGTCGAGCGCCTCCTGGCAACGGTCGCTATGGTGACTGCCGACGTCACGCACGACTTCGGTTGCCATGGCCCTCGTGACGTTAGCGACCGTGTCAAACAGTGTAGGAAACCCCGCGCGGCGGTCGCCATGGATACTGGCGGGGGGGAGGGGTGGAGTTTAGAGGAAGCGGAAGTGTCAGCGCAAGCGGAAGTGGTACTGCCCTGAATACCCCGAGCAGCGAAACGGAGGACAGCTTGATACTCCCATCGTTAACAGACACAAATCAGGACTCGAAATATATTCCAATG[T/C]GAGTTACACTACCCGCGAAGGCCGCTCGTGTGATAGTATGAATATTAGGGGTGTGTTTTGCTGTATTGTTGCTCATGTAAGCCCCCCTCATCATTGTCAATGGCGGAAGGTGTCTATTGTGGTTTGGGGCTGGGTACAAGGACTTAGGCCGAGGCGGGCGATGAGTAGCGATTATTGCCGAATTATTCCCGATTACATCCGATTTCTGTTTGAACCGCGCTGTTCTTTGTGTAAGCGCGTTATCAAGCGAGCATCGCGCCAAACAACCCTCTCCCCGTGCGGGAGCAACGGCCAGCGGCGTCCCGCGTCTATTCAGCGCCTGCCCGTCGCGAAAGCTAACCGGCTAACCAGTCGATAGACAAATTAACCAGACGAGTAAATCATGTACGTCGGCATCAGTAACGGACTAATTTAATTTGTCTCAAACAATCGACTCGCCTGATTAAATTCCACTAGGGAATGTGAGTGAGAGGGCGTTGCATTGGTGGCTAAAACTGCTA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8247
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025940 Nonsense 104 244 3 6
ENSDART00000143458 Nonsense 104 226 3 5
Genomic Location (Zv9):
Chromosome 6 (position 52170758)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52219940
GRCz11 6 52219939
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AKCTTGACATTGGTCTTGCCTCCTCTCTCTCAGGGTCTCCTGGAGAAGTA[C/A]CTCATTCCCAACGCTAGCCAGGCAGAGAGCAAAGTCTTCTACCTGAAAAT
Long Flanking Sequence:
TCATTTCTAAGGAAAGGGTTCATTTTTTCAAATAAAATTTTCAATTTATGCACTAAAAACGAAGCATAAATTGTATAATATAGACATATTTTTAAAAAATGACTAAAACAACCATTACCATATCTAAAATTCAAATGAAAATGAGAAATCGAATAAAATAAAACCTAATTCTAAGTCAAAAGAGTGTCTGCTCTATATTAAAATAACATAAAATAACACACAGTTGCTTTCCGTGTTAAATTGTACTAAGTCTAAGTTGTTTTCAGCTAGAATGTTTCATATGTATCAGCAAGGCCGTTTTAAAATCAGAGAAAAATGTATAAATATGAAACTGATCTTATGAGAAATGCAATTTGTATGGATCCAAAGATGAACTCGACTGTTGTTCTTCCTCTTTCTAACGGCTAATAATTTTCATTGTATTTTTTCCCATGTATTATTAATCCTCATAGCTTGACATTGGTCTTGCCTCCTCTCTCTCAGGGTCTCCTGGAGAAGTA[C/A]CTCATTCCCAACGCTAGCCAGGCAGAGAGCAAAGTCTTCTACCTGAAAATGAAAGGAGATTATTACAGATACCTGTCCGAGGTGGCATCCGGGGACTCAAAGAGAAGTGAGTTTGTTTGATTTGAAATGCTGCCTAAAAATGTCAGGTTTAAATGGCTGAAACAAAAACTAAGGCTCTGAAATAAACAGTTAGATGCTAGCCTGAAGAAACTGCATCAGGACATTCAGGCGGTGATGTTACGCTCATGAAATTGATTTTTGTGTTTTTCTATCGAATTACAGCCACAGTGGAGAACTCTCAGAAGGCCTACCAGGATGCATTTGAGATCAGCAAGAAGGAAATGCAGCCAACACACCCCATCAGGCTGGGACTAGCGCTGAACTTCTCCGTCTTTTACTATGAAATCCTCAACACCCCAGAGCAGGCCTGCAGTTTGGCAAAGACGGTCAGACGTTTTACTATCTGCTTGTTTAAATTTTTTTTACAACTTAATAGTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11447
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025940 Essential Splice Site 194 244 4 6
ENSDART00000143458 Essential Splice Site 194 226 4 5
Genomic Location (Zv9):
Chromosome 6 (position 52171206)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 52220388
GRCz11 6 52220387
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CTATGAAATCCTCAACACCCCAGAGCAGGCCTGCAGTTTGGCAAAGACGG[T/C]CAGAYGTTTTACTATCTGCTTGTTTAAANTTTTTTTACAACTTAATAGTT
Long Flanking Sequence:
ATAGCTTGACATTGGTCTTGCCTCCTCTCTCTCAGGGTCTCCTGGAGAAGTACCTCATTCCCAACGCTAGCCAGGCAGAGAGCAAAGTCTTCTACCTGAAAATGAAAGGAGATTATTACAGATACCTGTCCGAGGTGGCATCCGGGGACTCAAAGAGAAGTGAGTTTGTTTGATTTGAAATGCTGCCTAAAAATGTCAGGTTTAAATGGCTGAAACAAAAACTAAGGCTCTGAAATAAACAGTTAGATGCTAGCCTGAAGAAACTGCATCAGGACATTCAGGCGGTGATGTTACGCTCATGAAATTGATTTTTGTGTTTTTCTATCGAATTACAGCCACAGTGGAGAACTCTCAGAAGGCCTACCAGGATGCATTTGAGATCAGCAAGAAGGAAATGCAGCCAACACACCCCATCAGGCTGGGACTAGCGCTGAACTTCTCCGTCTTTTACTATGAAATCCTCAACACCCCAGAGCAGGCCTGCAGTTTGGCAAAGACGG[T/C]CAGACGTTTTACTATCTGCTTGTTTAAATTTTTTTTACAACTTAATAGTTCTGTTCTGAGTATATTCAGTGTACCGTTTGTTTTTATAACTCAATTATAACTTCTATTCATTCATCAAAAAGATTATTCTGTTTATTCTGAATACTAAGATGTATATTTGCAGTGTGCAGGCACAGTGCACCTGACCTTCATTTTTACTTTTACCATAGGCTTTCGATGAGGCAATTGCTGAGCTGGACACCTTGAATGAGGACTCTTACAAAGACAGCACCCTCATCATGCAGTTACTAAGGGACAACCTCACTGTAAGTGTTAGCTTTCTGCTTTCTTGTTTACTTTTTTTTTTATAGATGTAGAAAGACATCAAATTGAATGAATTCAATGCAAAATTATTATAGGGTGGACAGTTTACACATGGTTTAAGAATATTAGTACGAGTTGGCTAAAGTACATGCACTACCTTACATAAGTCTTGTCGTTGATCCCAGTTGTATGAGCAA
Associated Phenotype:
Not determined