Busch Lab

ZMP

itpk1

Ensembl ID:
ENSDARG00000013056
ZFIN ID:
ZDB-GENE-040426-1953
Description:
Inositol-tetrakisphosphate 1-kinase [Source:UniProtKB/Swiss-Prot;Acc:Q7ZU91]
Human Orthologue:
ITPK1
Human Description:
inositol 1,3,4-triphosphate 5/6 kinase [Source:HGNC Symbol;Acc:6177]
Mouse Orthologue:
Itpk1
Mouse Description:
inositol 1,3,4-triphosphate 5/6 kinase Gene [Source:MGI Symbol;Acc:MGI:2446159]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa8954 Nonsense Mutation detected in F1 DNA Not yet available
sa17725 Nonsense Available for shipment Available now
sa43454 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8954
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Nonsense 13 396 2 11
Genomic Location (Zv9):
Chromosome 20 (position 27115228)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27186531
GRCz11 20 27085621
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CWGTATTTAGAGATGCAGACGTTCGTGAAAGKAAAGCGAGTTGGATRCTG[G/A]CTCAGTGAGAAGAAGAYTAAAAAACTCAATTTCCAAACCTTCGTGGATTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17725
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Nonsense 94 396 5 11
Genomic Location (Zv9):
Chromosome 20 (position 27097386)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27168689
GRCz11 20 27067779
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTGTCTCTTTTCAGGACTACATAGACGCTCACCCTGAAACAGTGATTT[T/A]GGACCCTCTTCCGGCCATTCGTACCCTGCTGGACCGRTGCAAATCGTATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43454
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000008590 Essential Splice Site 169 396 8 11
Genomic Location (Zv9):
Chromosome 20 (position 27087296)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 27158599
GRCz11 20 27057689
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAGATACCATGTATATAGAATGTTGTGGAATGTGGTTTCTGTTTAATA[G/A]ATGGCCATCATCTTCAGCGAGGAAGATCTGAAAGACATCAAGCCTCCATG
Associated Phenotype:
Not determined