Busch Lab

ZMP

zgc:158412

Ensembl ID:
ENSDARG00000013051
ZFIN ID:
ZDB-GENE-061201-18
Description:
Uncharacterized protein C11orf53 homolog [Source:UniProtKB/Swiss-Prot;Acc:A0PJS5]
Human Orthologue:
C11orf53
Human Description:
chromosome 11 open reading frame 53 [Source:HGNC Symbol;Acc:30527]
Mouse Orthologue:
1810046K07Rik
Mouse Description:
RIKEN cDNA 1810046K07 gene Gene [Source:MGI Symbol;Acc:MGI:1917059]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20451 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20451
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019987 Nonsense 35 291 2 5
ENSDART00000135483 Nonsense 36 193 2 5
Genomic Location (Zv9):
Chromosome 5 (position 32026086)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29786916
GRCz11 5 30387069
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CGGTCAAAGATCTACTGGCCGAGAAGCGATTACGACAAACAAACACACCC[C/T]GATTCAGTGTAAGTTAGCCATCATGCACTGCATTGTCACCTGATATTCTT
Long Flanking Sequence:
GGAGGAAAACATATCCATTAACATGTACTAGTATATTATTCAAACTAAGCTTAATAGATTCTATAAATGAAAATAATGCTCTATTTTTAATGCTAGTAATTCACAAATAACAAATGGAAGTGTTTCCATTTCAGTAGGGAAATGCCTACATGATATAAGCCACTTTCAATGTGGACATTATTTGAAACAGACCAAGATAATTATTTATACATGTTTGTTCCCTTTATATCTTTGTTTGTTTACCTTTATTCTTGACAGTTTTCTCAAAGAACATCAGACTAACCGTTTTTACTGTTAAGCGTAGCATTTTTGTTTTGGACTATAATATATCAATAAAAACAGTGCACTTTTTTTGGGTGATGCCAGACTTTTCTTTTTAAACTGTAAATACACTTATTTTTCCCACAGAGTATTCCAAGAGAGTATACCAGGGAGTCCGTGTCAAGCATACGGTCAAAGATCTACTGGCCGAGAAGCGATTACGACAAACAAACACACCC[C/T]GATTCAGTGTAAGTTAGCCATCATGCACTGCATTGTCACCTGATATTCTTAAATATTATCTTAATCATGCCTTATCCATAAATGCGTTTCACTGTTTATTTTTTACAAAGTATCTAGCATTTGAATCCAGTAACTTGTTTGTACAAAGTATAAAGCATGAGTTCTCTCTCAGACAGTGTTCACAGCATCCATTCTTGTCATGTCCTTGTTACTATTAAGAGATAAATATCAGGCACACCTGCCAAAATCAGGCCGACCTTCCTGAAAGGGGACAGACAGGCATTGTTGTTAGACGGTTAAACCTAAGCCTTAACCAAGGGCATCATTGACGGATTTCCAACCAAAATACAAAAGAACAGACAGTCCTTGTGCAGAAGTGAACTCCTGCTGCAAGTTGTTGTCTGCTTTTGTTTGGTTTTGTCCCCTCATTGAAACTAATAGACCAGTCAGTTCATGCAAATTCATCAGACGGGGTGGTTGGCCTTAACATATATCTGAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5298
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019987 Nonsense 237 291 5 5
ENSDART00000135483 None None 193 None 5
Genomic Location (Zv9):
Chromosome 5 (position 32030275)
Other Location(s):
Assembly Chromosome Position
GRCz10 5 29791105
GRCz11 5 30391258
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GACGTCCCATACACAGCACCATCTTACACCTCTGCCTCCAGCTACTCCTG[C/A]CCACCGTACATGTCGACTCCTGGAGATMTGGCTGTGGTGAAGATGACAGC
Long Flanking Sequence:
TTTTCTTTTTTTTTTTCAAGGAATAATAATAATCTGATTTTACACTCCAAACTCACTCACTCACACATTTTCCTTCAGCTTCAGGATGTTGTATCAGGGGTCACCACATCAGAATGGACCACCAATACCCCAAAATATTTATGACATTTTATTTAAATGCAGAAACATATTTTTAAATAAATTAATAGATGGAGCAAAACCCATTTAAGTGAAAATATTACTAAGCAATGATGTTTCTCTATGCTACAGAGAGACCCATGGGATCAGCCATCAGAGGACTCGGTCAATCAGACAGAAGTCTTATGTCCTGAGGCTGCAGCCCCCGTGGCAGACTCACCATCCCTAGCTGGGCCTGACTCAGGCAGTTCCTCTCCGTACCGTCTGACCTCTGGTCGGAGTGGGAGCTCCATCCCATCCAGCTCTCAGCCATATACTCTACAGCCTCTGGAGGACGTCCCATACACAGCACCATCTTACACCTCTGCCTCCAGCTACTCCTG[C/A]CCACCGTACATGTCGACTCCTGGAGATCTGGCTGTGGTGAAGATGACAGCCGTCACTTCAGAGGAGGCCAGTGGTGGAGTGGTGTCTCTCAGTGACACTACATCCTGGGCTAAAGATGATGGAACAGGATCCTGGTTGTCATATGAGACCAGAAGAGCTTTTTAAGAGGCCTCAATGACAATTACAGGACTGTGGACTAATCATTTTGCAATTATGCAGCCTCTCTATTCTTACACAAAAGGAGATTATATAGATTCATCATAACGATGAAATGCTGGTCATAAAAAACTGCATACCACATATAGATACAGTAAAACATGTGCTGTTAGTCTAGTTAATTCATGGTTTAATTGTGCATTTTTTAATTTCCAAGCGTTTTAGAATAAATTAGAGGTAATGCTCCATTTCCCCCTCTTTCTTACAATTCCAAGTGTAATATTACTCCCAAAAACGTACATTTTGACTGGAAACATAACATAAACCAACATTTTTCTGCTCAA
Associated Phenotype:
Not determined