Busch Lab

ZMP

si:dkey-24n17.6

Ensembl ID:
ENSDARG00000013024
ZFIN ID:
ZDB-GENE-091113-7
Human Orthologue:
ERAP1
Human Description:
endoplasmic reticulum aminopeptidase 1 [Source:HGNC Symbol;Acc:18173]
Mouse Orthologue:
Erap1
Mouse Description:
endoplasmic reticulum aminopeptidase 1 Gene [Source:MGI Symbol;Acc:MGI:1933403]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa15064 Nonsense Available for shipment Available now
sa41570 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa15064
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048874 Nonsense 289 931 5 19
ENSDART00000122146 Nonsense 259 872 6 20
ENSDART00000124804 Nonsense 255 901 4 19
ENSDART00000147031 Nonsense 290 933 4 18
Genomic Location (Zv9):
Chromosome 10 (position 2932043)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2877680
GRCz11 10 2904851
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACCGCCGTCACAATGCTYGACTTTTATGATGAGTATTTTGACATCCCGTA[T/A]CCGCTTCCCAAACACGGTGAGTGYGAAAGTTATCAGCAGTGGTCAGTTTT
Long Flanking Sequence:
ATAAAACAAATAAGACTTTCTCCACAAGAAAAAATATTATCAGACATGCTGTGAAAATTTCCTTGCTCTGTTAAACATCATTTGGGAAATATTTAAAAAAGAAAAAAAATTCATAGGGGGGCTAATAATTCTGACTTCGACTGTACATTCTAATGCTGAAGCTTATGTCACCCAATAGCTGAGAACTGTAGAGCTGGCTGACGGGATTCTGGAGGATCAATTTGACACCATGGTAAAGATGAGCACCTACCTGGTGGCCTTCATCATCTGCGACTTCCACTCCATCAGTAAAAAAAGTCAGCACGGAGTTGAGGCAAGTCAATAAATAGCCTTTCTAAAGTAACCAGACCTCAAGAAAACAGTCCTCTCACTCTTCATATCCTGATTTTATTGCAGATATCAGTGTATACAGTTCCCGAGAAGATCAGTCAAGCGGAGTATGCCCTCGACACCGCCGTCACAATGCTCGACTTTTATGATGAGTATTTTGACATCCCGTA[T/A]CCGCTTCCCAAACACGGTGAGTGTGAAAGTTATCAGCAGTGGTCAGTTTTGCTACTGAAAATGGTTTGCATGATTAAGAGATTGTTCACTCACAAATGAAAATTTACTCACCGTTTACTCGCCCTCATGTGCTTTATACCCATTATTTTCTTATACTCGTATGGTTGAAGCTAGATATATTACCCCTTCTGAATTATTACAAACTTTAAACATAATAGTTTTAATAACTCATCTCTAATAACTGATTTATTTGATCTTTGCCATGATGACAGCACGTAATATTAGACTAGATATTTTTCAAGGCACTAGTATTCCACTTAAAGTGACATTTAAAGGCTTAACTAGGGTAATTAGGTAAATTTAGGGTAGTTAGACAAGTTATTGTATAACAGTGGTTTGTTCTGTAGACAGTCCAAAACAAATATAGCTTAAAGGGGCTAATCATTTTGACCTTAAAATGGTTTTAAAAAAAATTTTAAACTGCTTTTTATTCGAGCTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41570
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048874 Nonsense 768 931 16 19
ENSDART00000122146 Nonsense 703 872 16 20
ENSDART00000124804 Nonsense 731 901 15 19
ENSDART00000147031 Nonsense 766 933 15 18
Genomic Location (Zv9):
Chromosome 10 (position 2944009)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2889646
GRCz11 10 2916817
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACTGTTCTTTTGTTTCAGGCTTCCTACCGACGTCAGTTTGGTGGTCTA[C/A]ACTGAAGGGGCGCGAACAGACGACGGCTGGGACTTTTTGTTAGAGAAATA
Long Flanking Sequence:
GAATTGTTATTTAGCGGATGTTATTTCAGAATAACATACCTTGTAATGTCACGACTGACCAATCAGGAGCGAGTATTCCTGTCAGCCGTGTAATAATGTGTAATGACATATTAAAAAGCTGTAATCATTTTATCAAAATCATTTCAAATTTCAGTTGTATTTGTTTTATTAATTCAACTTATAGCTACAGTGTTTATGGTTACTTCTCACTGTTCATTTTAATGCACTACGTAACGTTTCTTATAATATTATAAAGTGTTATCCTTTTGTTCCTTATATTCCTTTTGCAAATGAATCTGTTTAAAGCATTTATCCACTCTGAATGTGTATATACACAAAACACTAAGTATTTTTTTGGTTGTTATGAGTGTTAAATGAACCTTTTTTGCAGCTTAGCTCAATATCGCAATAATACTGTAAATCTTGATAAAAGCCTAGAATGATGCAGACTCACTGTTCTTTTGTTTCAGGCTTCCTACCGACGTCAGTTTGGTGGTCTA[C/A]ACTGAAGGGGCGCGAACAGACGACGGCTGGGACTTTTTGTTAGAGAAATACAAGCGATCCGTCTCTCCATCAGAGAAGTGGATGATTAAAGCTGCCCTCTCGTACAGTCCACTAGCTCACAAACTTCAGTGGTGAGTCTGCAGCTGCTGAGATGTCGTTTTCCTACAGTAGTTCACCCAAACATGACAATAACCCTTGAAATCTGCGCGAAACGGTAGTTGCAGACTTTTATTTTAAGTATGTTGCCCCCCGTTTATTTTTTTCCCCAATTTCTGTTTGACGGAGAGCAGATTTTCTCAGCACATTTCTAAACATAATAGTTTTAATAACTTATTTCTATTAACTGATTAATTTTATCTTTGCCATGATGACAGTAAACAATATTTGACTAGATATTTTTCAGGACACTTCTATACAGCTTACAGTGACATTTAAAGGCTTAACTAGGTTAATTAGGGTAACTAGGCAGGTTAGGGTAATTAGGCAAGTTAATATATAAC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa6155
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Essential Splice Site, Missense, Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000048874 None None 931 None 19
ENSDART00000122146 Missense, Splice Site 872 872 20 20
ENSDART00000124804 Essential Splice Site 899 901 19 19
ENSDART00000147031 None None 933 18 18
Genomic Location (Zv9):
Chromosome 10 (position 2948449)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 2894086
GRCz11 10 2921257
KASP Assay ID:
554-4609.1 (used for ordering genotyping assays)
KASP Sequence:
AATGTTCCCACAATTCACAAAAACAAACGTGTGTGTGTGTGTGTGTGGCT[C/A]CAGACTGCAGTTTCAGCTCCAGWGCAGANTTTTACAGCGGTTKCACACWG
Long Flanking Sequence:
AGCTACCCCCCCCCCCCCTCCCTCAAAAAACAAAACAAAAAAAATATAGATTGTTGTGTGACTCCATCTTTGTTTGTTTGTGGTGTAGGTAGAGTTGTTCTTTGGGTCACTGGCGCAGGATCAGGGCTCCGGGCTCCGCAGTATCCAACAGGCCCTGGAGAAAATCCAGCAGAACATCCTCTGGATGGACAGGAACGTCCCACTGCTGAAAGCCTGGCTGGACCATCACACTTCATGATGCTTCAGAAAGTGTGTTCGTGTGTGTGTGTGTGTTTGTGTGTGTGTGTGTGTGTGTGTGTGACATCAGGACACAAATCTGTATAATGTTATACAGTAGGTTTTTTCAGGAAGTAAAACTGCTTCCTGTGAGGGTTGGGTTTAGGGGTATGGTGGGGTTTAGGGCAATACAAAATAAAGTTTGTACAGTACAAAAACAATAGAAACCTATGGAATGTTCCCACAATTCACAAAAACAAACGTGTGTGTGTGTGTGTGTGGCT[C/A]CAGACTGCAGTTTCAGCTCCAGTGCAGATTTTTACAGCGGTTGCACACTGCAAGTGTAACTGCAGCTGAAGACTCGTGACTGTTGTAGAGCATCCGCATCTGCTCCAAACGGCAGATCGAAGGAACTTAGCCAGGACATCGGGGTTAAACCCTTACTCTTTACCAGAAATGCCATCGGCTTAACGTCTCATCTGAAAGACGGCGCTTACTGACAGCATGGTGTCCCCTTCACTATACTGGGGCATTAGGACTCACACAGACCACAGGTTGAGCGCCCCCTGCTGGCCTCACTAACACCACTTCCAACAGCAGCCTAGTTTTCCCATGTGGTCTTCCATCCAGGTACTGACCAGGCTCAGCCCTGCTTAGCTTCAGTGAGTAACCGGTCTCGGGCTGCAGGGTGATATGGCTGTGGCGAAGGTAACTTCACTCCTGTGATGCTCCATTAATGCTGAAAAGTACATAGAGATTGTGGAGCACAATATGCTGCCGACTTTTCC
Associated Phenotype:
Not determined