Busch Lab

ZMP

adrbk2

Ensembl ID:
ENSDARG00000013007
ZFIN ID:
ZDB-GENE-030616-382
Description:
beta-adrenergic receptor kinase 2 [Source:RefSeq peptide;Acc:NP_001128197]
Human Orthologue:
ADRBK1
Human Description:
adrenergic, beta, receptor kinase 1 [Source:HGNC Symbol;Acc:289]
Mouse Orthologue:
Adrbk1
Mouse Description:
adrenergic receptor kinase, beta 1 Gene [Source:MGI Symbol;Acc:MGI:87940]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa2558 Nonsense F2 line generated Not yet available
sa5588 Nonsense F2 line generated Not yet available
sa2560 Nonsense F2 line generated Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27686
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Essential Splice Site 249 688 9 21
ENSDART00000134164 None None 278 None 8
Genomic Location (Zv9):
Chromosome 10 (position 45858367)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44287594
GRCz11 10 44134391
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAACTCTGGCGCTTAATGAGAGAATCATGCTGTCGCTGGTCAGCACCGGG[G/A]TGAGTGACACTATATAAATAAACATTTTAATTTTTCATATCCGGAAGATT
Long Flanking Sequence:
CATGCATACAGTCGTTTCACCACACTAATTTGTTTCTTGAGAACGATTTGATCATCTAAAAGTCTTTTGCTTTGCTGTGTAGTGACAAGTTTACACGTTTCTGCCAGTGGAAGAATGTAGAGCTCAACATCCATGTGAGTTTGCATGTTTATTCATTTGTACACTTTCTGTTTACATCCATAAGTCTGGTTTTCTCTGATATTCTCCTGATTTTGCTTGTAGTTGACAATGAATGACTTCAGCGTGCACCGCATCATCGGCAGAGGAGGCTTTGGAGAGGTTTATGGATGCAGAAAGGCAGACACGGGGAAGATGTAAGTGCTTTCCTGACATTTAAACCCTGAATAAGCTCATTTTGAGGTTGTTTAAAAGCACCTGCTCATTAACGCTCGTGTCTCAGGTATGCTATGAAGTGTCTGGATAAAAAGCGTATCAAAATGAAGCAGGGAGAAACTCTGGCGCTTAATGAGAGAATCATGCTGTCGCTGGTCAGCACCGGG[G/A]TGAGTGACACTATATAAATAAACATTTTAATTTTTCATATCCGGAAGATTCAGAGTCAAAATCCTGTCGAATATGTGATGATTCAAATCAGTTTGCATGTTAAATGAAGAAAACAAAACAAAACATGCAACGTCAACCGCCCCAATATCCACTGAAGAATGTGTAGAATGAGTATTACGGCTGCACGATGCTGGAAAAATATGTGACAATGCAATATTGTTGATGAGTATAACCAAATTTCTTAGAATATAACATTTACCTAGAAAAGCACAATTTTTATTAGCTGTTTTAAAATCATTTTTTATGTTCTGATATTAAATTAAGCAAGTAATTGTCTCAGTCTCAGACAAAAAAAAAAACGGTGCAAACATCTTTGTCTTTGATACACCATGAATGAGTGAAAACCACAGCAGATATTCTGACTCTGTGGTTAATTTCACCCCTTGTCTCGACTCCACCCATTAGTGTTTATCTTCAGCTCTGGGTTCACCTTCTAGCCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2558
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
Genomic Location (Zv9):
Chromosome 10 (position 45894608)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44323835
GRCz11 10 44170632
KASP Assay ID:
554-3099.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGTGAAGGAKCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA[T/A]CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAA
Long Flanking Sequence:
CTTGGTCAGACTTTATTTTGATGGTCTCTACTGCACGTTTTGTTGACTAAAAGCTGCATTGCTACATGCCAATGACTTCTCATTTGAGTATGAGTAGACTGTCTGCTTCATATCTGCTGATACCGCTCCTTCAACAGACATTTAACTGACCATAAGAACCTTTGCAAGTACATGTCAACTTACACTAACCCTAACCTGACAGTCTACTTATAATCTAATGAGAATGAGTTGCCATATAGATGCAATGTAACCCAAATTCAACTAAATGCATTAAAGGGACCATCAAAATAAAGTGAGAGCGATTACTTTTGTTATTTAAAAACCTGAAGTGTATTACCAGCCTTCTCTAATATTTAAAATACAACTGTATTGCATTACAATGTGGCTAATATATGTTATTGATAAACACTAGATTGATTTCCTGCTTTTAAATAATCCACTAGGGCGTCAGAGGTGAAGGAGCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA[T/A]CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAAAGGGGTAGTTCACCCAAAGTTCAAATGTACTCACTATTTACTCATCCTTAAAGTCTGAATATCGGTAACCATTGACTTCCATTGTAGGATAAACAAATACTACAGAAGTGAATGGCTACAGGTTTGTGGCATTTTTCAAAATGTCTTCTTTTGTGTGCAACAGAAGAATGAAATCTGTAAAGGTTTTAAACGTGAAGTGAGAGTGACAGATTTTTCATTTTTGGGTGAACTGTCTCTATATATAAATATAAGACGACGATAATAACACTAATGCTGATGTTGTTGAATAAAACACAAAAATCTGAATTTCTATAGGTTGTTTTCACGTGGTTCTGGTGATGTGTGAAATTCAGATGGAGGGCAGGAAGGAAAACTGAATGGGAAAGTCCATATTTTAGCGATTTAAACCATATTTCCAAGGAGATATAAATATAAAATATCCACATATGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa5588
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
ENSDART00000022369 Nonsense 462 688 16 21
ENSDART00000134164 Nonsense 143 278 5 8
Genomic Location (Zv9):
Chromosome 10 (position 45894608)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44323835
GRCz11 10 44170632
KASP Assay ID:
554-3099.1 (used for ordering genotyping assays)
KASP Sequence:
GAGGTGAAGGAKCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA[T/A]CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAA
Long Flanking Sequence:
CTTGGTCAGACTTTATTTTGATGGTCTCTACTGCACGTTTTGTTGACTAAAAGCTGCATTGCTACATGCCAATGACTTCTCATTTGAGTATGAGTAGACTGTCTGCTTCATATCTGCTGATACCGCTCCTTCAACAGACATTTAACTGACCATAAGAACCTTTGCAAGTACATGTCAACTTACACTAACCCTAACCTGACAGTCTACTTATAATCTAATGAGAATGAGTTGCCATATAGATGCAATGTAACCCAAATTCAACTAAATGCATTAAAGGGACCATCAAAATAAAGTGAGAGCGATTACTTTTGTTATTTAAAAACCTGAAGTGTATTACCAGCCTTCTCTAATATTTAAAATACAACTGTATTGCATTACAATGTGGCTAATATATGTTATTGATAAACACTAGATTGATTTCCTGCTTTTAAATAATCCACTAGGGCGTCAGAGGTGAAGGAGCACGTGTTCTTCAAGGGAATCGATTGGCAGCAGGTTTA[T/A]CTCCAGAAGGTGAGACCTTTGCCCTTTTTCTTTTCTTTTATCGAGCCTAAAGGGGTAGTTCACCCAAAGTTCAAATGTACTCACTATTTACTCATCCTTAAAGTCTGAATATCGGTAACCATTGACTTCCATTGTAGGATAAACAAATACTACAGAAGTGAATGGCTACAGGTTTGTGGCATTTTTCAAAATGTCTTCTTTTGTGTGCAACAGAAGAATGAAATCTGTAAAGGTTTTAAACGTGAAGTGAGAGTGACAGATTTTTCATTTTTGGGTGAACTGTCTCTATATATAAATATAAGACGACGATAATAACACTAATGCTGATGTTGTTGAATAAAACACAAAAATCTGAATTTCTATAGGTTGTTTTCACGTGGTTCTGGTGATGTGTGAAATTCAGATGGAGGGCAGGAAGGAAAACTGAATGGGAAAGTCCATATTTTAGCGATTTAAACCATATTTCCAAGGAGATATAAATATAAAATATCCACATATGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27687
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 576 688 19 21
ENSDART00000134164 Nonsense 257 278 8 8
Genomic Location (Zv9):
Chromosome 10 (position 45913262)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44342489
GRCz11 10 44189286
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCATGCACGGCTACATGCTAAAGCTAGGAAACCCCTTCCTGACGCAGTG[G/A]CAGCGGCGCTATTTCTATCTGTTCCCCAACCGTGTGGAGTGGAGAGGTGA
Long Flanking Sequence:
ATGTAATTGTAGGTGCGTATGATTAGATCATTGGTTCCGACGCATTTGTATCTTGAACAGTTCGATAATAAAATGAAATGTCCGTGTCTTTGAGAATAAAGTTAGATGTCCCAATCTATTTATTGTCCATTTAGTCAAAAGTAAACATCCAAATAAACATGAACTCATTCTCAAGTCCATCATAGTCAAAAGGTTTGTTTGACCTTCTTTTACGCCCCGCAGGTCATCAATAGGAGAGCATAAATACATTAAAATACATTATACACCCTCTAGTGGTGTGAAAGAAAATTACACAAAAAATGGCTCCTACAGTAATAATTAAAAATAGATGTAAATTAATTCAGCTTTTTTTTTCAATTTGGATATAATACTCAGCATTCAACTGTCAAGCATATGATCATTCTCCTTGTGTGTGACTTTTGTGCAGATTACGCGCTGGGGAAGGACTGCATCATGCACGGCTACATGCTAAAGCTAGGAAACCCCTTCCTGACGCAGTG[G/A]CAGCGGCGCTATTTCTATCTGTTCCCCAACCGTGTGGAGTGGAGAGGTGAAGGAGAGTCTCGGGTAAGAGCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACGTGTTTTTTGTGACATATCAGGACACAAATCTGTATAATGGCATGGGTATGACACAGGTATTACAAAAAGGAGGTGAAATATGAGGACATCGGTGACGTCCTCATTTCTCAAAATGCTTATAAATCCTACAGGATGAGTTTAATCAGAGAGTAAAGCTGCACACAGTCTCCTGTGATGGTTGGGTTTAGGGGTGGGGTGAGGGTGAGGGCAATACAATATACGGTTTGGACAGTATAAAATGAATGGAAACCTATGTAATGTCCCCACTTTTCACAAAAACAAATGTGTCTGTGTGGTGTGTGTGTGTTGTCACTGCTGTTTATATCAATATAATTGGTTAACCGACAGATTTCTGAGATTGAATGTTGCCTGTTTGTCCATACGCTGTAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2560
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 582 688 19 21
ENSDART00000134164 Nonsense 263 278 8 8
ENSDART00000022369 Nonsense 582 688 19 21
ENSDART00000134164 Nonsense 263 278 8 8
Genomic Location (Zv9):
Chromosome 10 (position 45913280)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44342507
GRCz11 10 44189304
KASP Assay ID:
554-3153.1 (used for ordering genotyping assays)
KASP Sequence:
CTAAAGCTAGGAAACCCCTTCCTGACGCAGTGGCAGCGGCGCTATTTCTA[T/A]CTGTTCCCCAACCGTGTRGAGTGGAGAGGTGAAGGAGAGTCTCGGGTAAG
Long Flanking Sequence:
ATGATTAGATCATTGGTTCCGACGCATTTGTATCTTGAACAGTTCGATAATAAAATGAAATGTCCGTGTCTTTGAGAATAAAGTTAGATGTCCCAATCTATTTATTGTCCATTTAGTCAAAAGTAAACATCCAAATAAACATGAACTCATTCTCAAGTCCATCATAGTCAAAAGGTTTGTTTGACCTTCTTTTACGCCCCGCAGGTCATCAATAGGAGAGCATAAATACATTAAAATACATTATACACCCTCTAGTGGTGTGAAAGAAAATTACACAAAAAATGGCTCCTACAGTAATAATTAAAAATAGATGTAAATTAATTCAGCTTTTTTTTTCAATTTGGATATAATACTCAGCATTCAACTGTCAAGCATATGATCATTCTCCTTGTGTGTGACTTTTGTGCAGATTACGCGCTGGGGAAGGACTGCATCATGCACGGCTACATGCTAAAGCTAGGAAACCCCTTCCTGACGCAGTGGCAGCGGCGCTATTTCTA[T/A]CTGTTCCCCAACCGTGTGGAGTGGAGAGGTGAAGGAGAGTCTCGGGTAAGAGCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACGTGTTTTTTGTGACATATCAGGACACAAATCTGTATAATGGCATGGGTATGACACAGGTATTACAAAAAGGAGGTGAAATATGAGGACATCGGTGACGTCCTCATTTCTCAAAATGCTTATAAATCCTACAGGATGAGTTTAATCAGAGAGTAAAGCTGCACACAGTCTCCTGTGATGGTTGGGTTTAGGGGTGGGGTGAGGGTGAGGGCAATACAATATACGGTTTGGACAGTATAAAATGAATGGAAACCTATGTAATGTCCCCACTTTTCACAAAAACAAATGTGTCTGTGTGGTGTGTGTGTGTTGTCACTGCTGTTTATATCAATATAATTGGTTAACCGACAGATTTCTGAGATTGAATGTTGCCTGTTTGTCCATACGCTGTAGGAATGTTGGACTAAAACGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa5589
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022369 Nonsense 582 688 19 21
ENSDART00000134164 Nonsense 263 278 8 8
ENSDART00000022369 Nonsense 582 688 19 21
ENSDART00000134164 Nonsense 263 278 8 8
Genomic Location (Zv9):
Chromosome 10 (position 45913280)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 44342507
GRCz11 10 44189304
KASP Assay ID:
554-3153.1 (used for ordering genotyping assays)
KASP Sequence:
CTAAAGCTAGGAAACCCCTTCCTGACGCAGTGGCAGCGGCGCTATTTCTA[T/A]CTGTTCCCCAACCGTGTRGAGTGGAGAGGTGAAGGAGAGTCTCGGGTAAG
Long Flanking Sequence:
ATGATTAGATCATTGGTTCCGACGCATTTGTATCTTGAACAGTTCGATAATAAAATGAAATGTCCGTGTCTTTGAGAATAAAGTTAGATGTCCCAATCTATTTATTGTCCATTTAGTCAAAAGTAAACATCCAAATAAACATGAACTCATTCTCAAGTCCATCATAGTCAAAAGGTTTGTTTGACCTTCTTTTACGCCCCGCAGGTCATCAATAGGAGAGCATAAATACATTAAAATACATTATACACCCTCTAGTGGTGTGAAAGAAAATTACACAAAAAATGGCTCCTACAGTAATAATTAAAAATAGATGTAAATTAATTCAGCTTTTTTTTTCAATTTGGATATAATACTCAGCATTCAACTGTCAAGCATATGATCATTCTCCTTGTGTGTGACTTTTGTGCAGATTACGCGCTGGGGAAGGACTGCATCATGCACGGCTACATGCTAAAGCTAGGAAACCCCTTCCTGACGCAGTGGCAGCGGCGCTATTTCTA[T/A]CTGTTCCCCAACCGTGTGGAGTGGAGAGGTGAAGGAGAGTCTCGGGTAAGAGCTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTACGTGTTTTTTGTGACATATCAGGACACAAATCTGTATAATGGCATGGGTATGACACAGGTATTACAAAAAGGAGGTGAAATATGAGGACATCGGTGACGTCCTCATTTCTCAAAATGCTTATAAATCCTACAGGATGAGTTTAATCAGAGAGTAAAGCTGCACACAGTCTCCTGTGATGGTTGGGTTTAGGGGTGGGGTGAGGGTGAGGGCAATACAATATACGGTTTGGACAGTATAAAATGAATGGAAACCTATGTAATGTCCCCACTTTTCACAAAAACAAATGTGTCTGTGTGGTGTGTGTGTGTTGTCACTGCTGTTTATATCAATATAATTGGTTAACCGACAGATTTCTGAGATTGAATGTTGCCTGTTTGTCCATACGCTGTAGGAATGTTGGACTAAAACGT
Associated Phenotype:
Not determined