Busch Lab

ZMP

si:ch211-107n23.1

Ensembl ID:
ENSDARG00000013000
ZFIN ID:
ZDB-GENE-030131-7905
Description:
liprin-alpha-2 [Source:RefSeq peptide;Acc:NP_001038576]
Human Orthologue:
PPFIA2
Human Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al
Mouse Orthologue:
Ppfia2
Mouse Description:
protein tyrosine phosphatase, receptor type, f polypeptide (PTPRF), interacting protein (liprin), al

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa2166 Essential Splice Site F2 line generated Not yet available
sa33462 Nonsense Mutation detected in F1 DNA Not yet available
sa31397 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa2166
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Essential Splice Site 151 1154 4 28
ENSDART00000142140 Essential Splice Site 233 1236 5 29
Genomic Location (Zv9):
Chromosome 4 (position 20952159)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22295494
GRCz11 4 22016469
KASP Assay ID:
554-3221.1 (used for ordering genotyping assays)
KASP Sequence:
GGCAGAGGACCTGTTGGAGGGGACTGATGCCCAGAAACTTCATAGCAAGG[T/C]TAGTATTGACTGCTGCCAGGATTNNNACTCCCTCAGAGCAGTTCATTTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26294
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Essential Splice Site 562 1154 14 28
ENSDART00000142140 Essential Splice Site 644 1236 15 29
Genomic Location (Zv9):
Chromosome 4 (position 20926232)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22269567
GRCz11 4 21990542
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTTTCATAACTCACTGTGAGTGTGTGAACTTTTTTTCTTAATTTCTCC[A/T]GGTTGATCCAGGAAGAGAAGGAGTCGACTGAACTGAGGGCAGAAGAGATT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33462
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Nonsense 1080 1154 26 28
ENSDART00000142140 Nonsense 1162 1236 27 29
Genomic Location (Zv9):
Chromosome 4 (position 20910521)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22253856
GRCz11 4 21974831
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAATTCTAGAGAGGGAATACAACAATCTGCTGGCACTGGGAACAGAGAGA[C/T]GATTAGATGAGGTCAAGCTGTAGTTTTTTGTCTTTTATATAGAACTTTGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31397
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000034834 Nonsense 1152 1154 28 28
ENSDART00000142140 Nonsense 1234 1236 29 29
Genomic Location (Zv9):
Chromosome 4 (position 20898015)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 22241350
GRCz11 4 21962325
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTCGGACCTTCAGCAGTACAGCGTCTGGACAGCTCCACTGTGAGGACCTA[C/A]TCTTGCTGAGATCTGCGTCTGCGCCACAAGCTGTGAGTTCACCTCTTTCC
Associated Phenotype:
Not determined