Busch Lab

ZMP

gpia

Ensembl ID:
ENSDARG00000012987
ZFIN ID:
ZDB-GENE-020513-2
Description:
glucose phosphate isomerase a [Source:RefSeq peptide;Acc:NP_658909]
Human Orthologue:
GPI
Human Description:
glucose-6-phosphate isomerase [Source:HGNC Symbol;Acc:4458]
Mouse Orthologues:
Gm1840, Gpi1
Mouse Descriptions:
glucose phosphate isomerase 1 Gene [Source:MGI Symbol;Acc:MGI:95797]
predicted gene 1840 Pseudogene [Source:MGI Symbol;Acc:MGI:3037698]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa31115 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44355 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa44356 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa31115
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 161 553 5 18
ENSDART00000022437 Essential Splice Site 161 553 5 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37011234)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35418850
GRCz11 25 35923789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCATCACTGATGTGGTGAACATCGGCATCGGAGGATCAGACCTGG[T/A]GAGTTTCCTAAAGCACCCCAGAACTGATTGTAAAGAAATCTGATCAGAGA
Long Flanking Sequence:
ATTTGATTGATTTATTTAATATTTTATTTATTTATTTTATTTATTTATTTAATTATTTATTTTATTTATTTATTAAATTATTTATTTTATTATTTGTTTATTTATTTTATTATTTTATTTATTCTTTTGTGCGTGCCCCAGTAGAGCTTTTATGTCTAACAACGCCCCTGGGTGGTTTTGGTTTCTTCTGTAAATCATAATAAAAATCTTGTATGATCATTTTTATTGCTGTTGAGGGAACTCTATCATGTACACTGTCCCCTGGCTATTATTTAAGCTTCTCCATAAACATTTTAGAGCAATACAACAATGATTTAACTAATTTATCAGATTATGTTTTATATTTGATTTGTTTATTTTATAACCAATTATGAAAAGTCCTGAACATAGATGTTGTGTGTCTGTTATTGTGCAGAAAGTGCGCAGCGGCGCTTGGAAAGGCTTCAGTGGGAAAAGCATCACTGATGTGGTGAACATCGGCATCGGAGGATCAGACCTGG[T/A]GAGTTTCCTAAAGCACCCCAGAACTGATTGTAAAGAAATCTGATCAGAGATGTCCGGCTGTCGAAATGAATGTTGAAAGGGATTAGTTTCGTGTAGGTGTAGACATTAATGGAATACAGTTTACTGGGTAATTTAATAAGTTAAAGAATAAAAATCTTCCAGTTCCTTCTAGACACAACCAAACCTGCCGGAACTACTTGCGGTGTGCTTATCTGACAATAGTTGCATGCCTTAATGTTCGTCAGCCAATCAGAATGGGGCACTTAACAGCCCTGCAGTTTACTTGTCAGTTTTTAGTTTACACATAATATTAGAGCTTCTTTTGATTTACATTTAGATATATCATATCGCAATACTGAAAGCAAAATTCATTTACCACTTGACTGCTTCATTTTGTGTGTATAAACTTTCCCAATTTAAGCATTAGTTGAACAACCCCTTTACCGTTAGTTTGCTATAAGGGTAAGATGTGCAAAAATAAAGCCCCACCTCCTACTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44355
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 161 553 5 18
ENSDART00000022437 Essential Splice Site 161 553 5 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37011234)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35418850
GRCz11 25 35923789
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAAAAGCATCACTGATGTGGTGAACATCGGCATCGGAGGATCAGACCTGG[T/A]GAGTTTCCTAAAGCACCCCAGAACTGATTGTAAAGAAATCTGATCAGAGA
Long Flanking Sequence:
ATTTGATTGATTTATTTAATATTTTATTTATTTATTTTATTTATTTATTTAATTATTTATTTTATTTATTTATTAAATTATTTATTTTATTATTTGTTTATTTATTTTATTATTTTATTTATTCTTTTGTGCGTGCCCCAGTAGAGCTTTTATGTCTAACAACGCCCCTGGGTGGTTTTGGTTTCTTCTGTAAATCATAATAAAAATCTTGTATGATCATTTTTATTGCTGTTGAGGGAACTCTATCATGTACACTGTCCCCTGGCTATTATTTAAGCTTCTCCATAAACATTTTAGAGCAATACAACAATGATTTAACTAATTTATCAGATTATGTTTTATATTTGATTTGTTTATTTTATAACCAATTATGAAAAGTCCTGAACATAGATGTTGTGTGTCTGTTATTGTGCAGAAAGTGCGCAGCGGCGCTTGGAAAGGCTTCAGTGGGAAAAGCATCACTGATGTGGTGAACATCGGCATCGGAGGATCAGACCTGG[T/A]GAGTTTCCTAAAGCACCCCAGAACTGATTGTAAAGAAATCTGATCAGAGATGTCCGGCTGTCGAAATGAATGTTGAAAGGGATTAGTTTCGTGTAGGTGTAGACATTAATGGAATACAGTTTACTGGGTAATTTAATAAGTTAAAGAATAAAAATCTTCCAGTTCCTTCTAGACACAACCAAACCTGCCGGAACTACTTGCGGTGTGCTTATCTGACAATAGTTGCATGCCTTAATGTTCGTCAGCCAATCAGAATGGGGCACTTAACAGCCCTGCAGTTTACTTGTCAGTTTTTAGTTTACACATAATATTAGAGCTTCTTTTGATTTACATTTAGATATATCATATCGCAATACTGAAAGCAAAATTCATTTACCACTTGACTGCTTCATTTTGTGTGTATAAACTTTCCCAATTTAAGCATTAGTTGAACAACCCCTTTACCGTTAGTTTGCTATAAGGGTAAGATGTGCAAAAATAAAGCCCCACCTCCTACTTAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44356
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 267 553 9 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37013624)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35421240
GRCz11 25 35926179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AAGTGAAGGAGTTCGGCATCGACACCAACAACATGTTTGAGTTTTGGGAT[G/A]TGAGTATGTGCTACAGAGCAATTTCCAGGACAGACTGAATGCATGATTGC
Long Flanking Sequence:
TTAATTTATTTAGTTTATTTATTTATTTCAGCCAAACAAAAAGAAATTACTTTCTCCAGAAGAAAAATATAGTGGAAAATCCTGTGAAAAATGTCCTTGCTCTGTTAAACAGCACTTTTATATAGATATTTAAAAAACTATTATCATTTTACAAGAGAGCTAATCATTTTGTCTTAAACTGTATAACATTAATACCAAAGTCAATCCTCCTGTAAAGAGCTTAATCATTTAAAGTATGAGATGTCAGAACTCTTATTATCGTCAGCACATTATAATCTGTTAATATACGGACACTAATAATTTATATTTGTATTTCAGAAATCTGCTGTGGCCAAACATTTCGTGGCTCTTTCCACAAACGCGGTGAGTACAGCAGCATAACTTCATGTATTCTCTTTTAAGTACAGTTTAATCAACGTGTATTTATTTCTGTCTCCCATTATCAGCCAAAAGTGAAGGAGTTCGGCATCGACACCAACAACATGTTTGAGTTTTGGGAT[G/A]TGAGTATGTGCTACAGAGCAATTTCCAGGACAGACTGAATGCATGATTGCCTGAAATATTGACTGCTCTGCCATATTGCTGAATCCACTTCTAAGTTAGTGTTGATTTGATGCTGATGTTTCAGTGGGTCGGCGGCCGCTATTCTCTGTGGTCTGCTATCGGCTTGTCCATCGCTCTGCACATCGGTACGTCTGCTGTGGGGAAAAGTCCCCAAATATGCTGTAATGTTTTTCAGGAGTGACAATTGACATGCAGCTAAGTCTGAAATTATTCAAATCTTTGGCAAACTCTGACTTGAGAGTTATTTTATTTAACCAGCAGTTTCTGTTGTTGTTGTTGCTATTATTTATTTTTGACCGGAAATGACTCCGACTTCTTCCAAAAGATAATAATATGATGTTCAAGAGGGATTATTGTGGGAAAAAATATATATGTTTTAGCTTTAATTTACATTTGAACAAAAATGTAAGTCCGAATTTGCAAGGGGTATGAATACGTTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa822
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022437 Essential Splice Site 465 553 15 18

The following transcripts of ENSDARG00000012987 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 25 (position 37020407)
Other Location(s):
Assembly Chromosome Position
GRCz10 25 35428023
GRCz11 25 35932962
KASP Assay ID:
554-0726.1 (used for ordering genotyping assays)
KASP Sequence:
GGCTTCTGGGTTGTCTGGAGACTCGCTGGAGAAACTCCTGCCTCATAAAG[T/C]GAGTTGCTCTTTATTTGACATGTCTTTGGAAAGGAGAYTTTTAAGTGCCG
Long Flanking Sequence:
GCGGGGCTATAAAGGCCTGTGTGTCAGCATAGTTGCAGATTCAAAAACAAGACTAGCGTCATATGCTAATGAGGGAGAACTGTTCACTAGTGGGCGGAGCTTCACCCTCTGATGACATCATACAAAGGGAGAATGTCAATCAAAGTGTTTCTGCAGACTGTTTCTATCAAGTCTGATTATAAATAATACAATTCATACAGTTTATTATAACTTTATGATTATATTCACACACTGTTGCCACACAGCTCCATATAAACCCCTTATAAAAGTGATTTGTGCATAGGAGCTCCCCTTTAAAGTGGAAATCCTGCTAATATTTGAAGCCGTTGTTGAGATATGTTATGCTCCTTTTACTTTATGAATCCCGCAGATCCTGATGGCGAATTTCCTGGCGCAAACAGAGGCTCTGATGAGGGGAAAGACTTCTGATGAGGCTAAGAAGGAGCTCCAGGCTTCTGGGTTGTCTGGAGACTCGCTGGAGAAACTCCTGCCTCATAAAG[T/C]GAGTTGCTCTTTATTTGACATGTCTTTGGAAAGGAGATTTTTAAGTGCCGATGGCCTGGTGGTTAGTGGACAAGCCTGGACATTTCTATGAATTAGTGTGTCGCGATACTGGAATTCGATATCAAACGATACTGAAATGGTAAAAGCGTCCATTTCCCGCTAACATTTAAGCGCTGTTGAGTTATTTCCATTGGAATATTCAACCAATTCCATCCATGTTCGATTAAAAAAAGGTCAGGAAAGGGTTTTTCTTCAATGTCAAAAATATTAGTAATTGATTGGATACAAATGAATATGCATATATATTTCCGAAATGCAATGCAACAGTTAAATTCAGGAGGTTTCGTGTCAATTTTCATTCCCTGACTCCAGCGTTTGTACTCGGTTTACCGTTTAGTGGAATTCATCACTTGTCAGTCATTCTCCAGTCCTCCGCACCCATACATGCGTCCTCCTTTTCTACGAATTCTCCACACAACATTAAAAGCATACGACTTCTC
Associated Phenotype:
Not determined