Busch Lab

ZMP

ENSDARG00000012949

Ensembl ID:
ENSDARG00000012949
Human Orthologue:
SCMH1
Human Description:
sex comb on midleg homolog 1 (Drosophila) [Source:HGNC Symbol;Acc:19003]
Mouse Orthologue:
Scmh1
Mouse Description:
sex comb on midleg homolog 1 Gene [Source:MGI Symbol;Acc:MGI:1352762]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8834 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18090 Essential Splice Site Available for shipment Available now
sa41867 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa15449 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa8834
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 143 684 4 20
Genomic Location (Zv9):
Chromosome 11 (position 31023773)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29901135
GRCz11 11 30148319
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAAAAACATTAAGTGGAGCAGAAATGGCTCCATCTTCAGCCTTTAAAAAG[G/A]TAATTTCTTTTWAAATCACAAAACCACATTAATAAGCTTTTTAAAACATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18090
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 297 684 13 20
Genomic Location (Zv9):
Chromosome 11 (position 31015412)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29892774
GRCz11 11 30139958
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TCAAAAGCTTGCGCTGTATTTCAGTTGGTTTTGTTCTGAATGGGTTTTTT[A/C]RGATTACAGYTGGTACCGGATTGCGATGTGGGTAWCAGTCTGGACTTGCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41867
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 306 684 14 20
Genomic Location (Zv9):
Chromosome 11 (position 30998917)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29876279
GRCz11 11 30123463
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTTTGTGAGAGTGTGTATTGATGTTTTATCCCTTGCTCTTTGTCTTTCA[C/A]ATTTACAGAGGAAACCAAAGGTTCCTCATTCACTTTCAAGCCCCATATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15449
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000006669 Essential Splice Site 346 684 15 20
Genomic Location (Zv9):
Chromosome 11 (position 30998321)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 29875683
GRCz11 11 30122867
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATTATTTGCTGGTTTTGAATTGTGCTTTATATTTGCGGTCATCTCTTCT[A/C]GTTTGTGTCTATGTGAATAAAYATRGTAACTCTGGRCCACACCTGGAYCG
Associated Phenotype:
Not determined