Busch Lab

ZMP

lgtn

Ensembl ID:
ENSDARG00000012929
ZFIN ID:
ZDB-GENE-040426-1226
Description:
ligatin [Source:RefSeq peptide;Acc:NP_957456]
Human Orthologue:
LGTN
Human Description:
ligatin [Source:HGNC Symbol;Acc:6583]
Mouse Orthologue:
Lgtn
Mouse Description:
ligatin Gene [Source:MGI Symbol;Acc:MGI:109342]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa10084 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa10084
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013446 Nonsense 169 590 5 15

The following transcripts of ENSDARG00000012929 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 38569247)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37424662
GRCz11 8 37457096
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AAGTGCTGAGATGAGAAACAGTGGAATGAAGGGGAAAGGAGTGAATGTTT[T/A]ACACACATACATGGAYCAGCTATGGTATGCTTTACAGAACGATTTAGTTT
Long Flanking Sequence:
TATCCAGCAAACTAATAAATGAACAATAATAACGAAGTGTGTTCAAAAAGTTATATCTAGAGACACATGCTGTGCCCCATATGGTCTGAAATCTAAGCTTGTTTTTAATAAAACAAATATAAATATGGATATAATAAATAATACTGCTAATAATGATAACATTATACAAAAGCAAATTGTCACCAATACACTTAAAAAGCCGGGTGTATGATAAGGGCCCTATATGTTTAACATCACCATGCTAATTTTTACTTTGTTGAGCAAATACATTTAATAATAATATGCAGAAAATTATCTGATTGTTGCTCTTTTTTTGTTTAGCTTTAACACTTTAAGCACTCGGTCTACATTATAAAAAAAAAAAATGCATCAAAATGTTGTTTATGGTTATTTTGTGACTTTTATTTTGTATTAAAGGGCACCAGTGGCTGTTGGCACAGCAGCTATGTCAAGTGCTGAGATGAGAAACAGTGGAATGAAGGGGAAAGGAGTGAATGTTT[T/A]ACACACATACATGGACCAGCTATGGTATGCTTTACAGAACGATTTAGTTTTTACATTCATTTAGATTTCTATTCCTGTCACTTAATGCATTCACTTTCTACAGACTTCTTCCTTAAATTCTCCACAGGGCGTTTGGGGATAAGACGCATCCTCCAGTTATACCTGTCACAAACTCTCCAACACAGGTGGAGGGAGAAGAAGAGGGTGAGGAATGTGAGGAGGAAGAAGAGGAGGTGAAAGACAGCTCTGAAAATGTTGCAGTGGAAACGGCTTGTCAAAGCTTGCAGGAGCTGAAGCTGGCTGAAAACGAGGTGTTGAAAGAAGAATCGGTTGAGGATAAAGAGGGAGAAAACATTGATGGAGAAGAGGGTGATTCTAGATCTCCGCAAGGTGAGATATCTTTGACTTTGTGTTTCATGACATTTTTATAGGTGTTTTGACTTGTCTGTCTGTCTCATTACAGAGCAGATGGATGAGTTATTGCTGCAGTGTTTCCTCCA
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2447
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000013446 Nonsense 391 590 10 15

The following transcripts of ENSDARG00000012929 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 8 (position 38565734)
Other Location(s):
Assembly Chromosome Position
GRCz10 8 37421149
GRCz11 8 37453583
KASP Assay ID:
554-3108.1 (used for ordering genotyping assays)
KASP Sequence:
GATGGGGCTTGTGAGGTTGAATATCAACCCCCGGAAATCACACCACTTTA[T/A]GGGGTTACTGCACGCCTGGAGCCGCTTTTTCAGGATGCCCACAAAAAGTT
Long Flanking Sequence:
CGCAGATTGTAAGATTTTATTATCTATAAGCTATATTATTTCAAATATCACAATCTTTCTTTTTGTTTTCCCCTCAGCTTTCCAAGTTTTTGCAAATCATGCAAAGAGATCACAGTTTGCTTCAGGTGAAGGAGCTGAGCAAAGGTGTAGAGAGCATTGTGGATGTTGACTGGAGAAACCCTGAGTATGTAGTCGCATAATTTATCTAATCCATTAATAAAATACAATAATATTGATATAATAAAAGTAATTTAATAATATAAATAATAATTAGTAAATAAATATGTTATTTTTATTATATTCTTTTATTAAATATTATATTTTTTCCAATATGGAGTAAGTGTTAACTATGAGGTAAATCTGTATATTTATTTCTATTTTATACTCTACAGGTTGTGCTCTTTCAAAATACCTGAGGACTGTGCACTAGAGAAAGAATTTGAAGAGGGCGATGGGGCTTGTGAGGTTGAATATCAACCCCCGGAAATCACACCACTTTA[T/A]GGGGTTACTGCACGCCTGGAGCCGCTTTTTCAGGATGCCCACAAAAAGTTAACGAGTGGAAACATCTTATTTATTTATTTTTTAAGTTTGTTAGTGGGATTGTTGAGGTTTTGAGTGAATAAACTTTTGTGTTTCAGAAAGGGAACATCTCTAAAGGCCACTGAAGTTAGGAATATCATTACAGAATATGTGAAGAAAAATGAACTTGTCAATGAAATCAATAAGAAGTAAGTTTAAAAGTTCTTGGCACCTTTTATGTCACGTTCAACAGTTTGAATGTTAAAATATTTGAAAAAAGTTTCAAATATTACTTTTGATTCACTAAATTTTGTTCAAATGTACATATTTTGTATTAAACATATTTAATTCGAATTCAGTAAGGATGCCTTACATTGATCAAATGTATTAAGTTTTCCAAAGAAATTACAATATTACAGACCCCAAATGTTTAATATTTAACATCGGTGCATGTTTTTTTTTTTTTTTTTCATGATTTTAGT
Associated Phenotype:
Not determined