Busch Lab

ZMP

si:dkey-74f15.3

Ensembl ID:
ENSDARG00000012914
ZFIN ID:
ZDB-GENE-070912-575
Description:
Novel protein similar to vertebrate Rho guanine nucleotide exchange factor (GEF) 4 (ARHGEF4) [Source
Human Orthologue:
ARHGEF4
Human Description:
Rho guanine nucleotide exchange factor (GEF) 4 [Source:HGNC Symbol;Acc:684]
Mouse Orthologue:
Arhgef4
Mouse Description:
Rho guanine nucleotide exchange factor (GEF) 4 Gene [Source:MGI Symbol;Acc:MGI:2442507]

Alleles

There are 13 alleles of this gene:

Allele Name Consequence Status Availability
sa25103 Nonsense Mutation detected in F1 DNA Not yet available
sa39799 Nonsense Mutation detected in F1 DNA Not yet available
sa44524 Nonsense Mutation detected in F1 DNA Not yet available
sa6828 Nonsense Mutation detected in F1 DNA Not yet available
sa32868 Nonsense Available for shipment Available now
sa13647 Nonsense Available for shipment Available now
sa39798 Nonsense Mutation detected in F1 DNA Not yet available
sa39797 Nonsense Mutation detected in F1 DNA Not yet available
sa19710 Nonsense Available for shipment Available now
sa17428 Nonsense Available for shipment Available now
sa39796 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa12665 Nonsense Available for shipment Available now
sa19709 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa25103
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 90 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16094606)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16605433
GRCz11 2 16274023
KASP Assay ID:
554-7646.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTTTAGAGGACTCTGGGAGTGAAGCAAGCTGTCTGGAGGATGGGGACTCC[C/T]AGCAGGAGGAATGTGGAGAGCAGCAGGACCACCAGGAATGGTGTGATCCG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39799
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 361 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16093791)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16604618
GRCz11 2 16273208
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTTGATGACACTGAGATCAGTTTATCTCCATCACAACACATTTCTGTATA[T/G]GAGTCTTTATCATTTGAGAAGCCTGTTGAACAGAAAGTTTTATCATCAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44524
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 633 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16092977)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16603804
GRCz11 2 16272394
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATCAGTAGAGCACAGCCAACCACAGATATCAGTAGAGCACAGCCAACCA[C/T]AGATGTCAGCAGAGCACAGGCAATCACAGATGTCAGTAGAGCACAGCCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6828
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 995 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16091889)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16602716
GRCz11 2 16271306
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACTTCAAATCACTAGACAACACARARCACAAGCAATYAGACATRAGTTA[T/A]ATAARCTGCAGYCAATCACAGGCCTCAGTAGAAATCTKGCAATCAYACGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32868
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 1139 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16091459)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16602286
GRCz11 2 16270876
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTCAACAGTACACAGCCAATCACAAACTTCAGTGGGACAAAGCCAATCC[C/T]AGGATTTGGTAGAACAAAGTCGATCACCAGCTGCAGCCGAAAACAGTCAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13647
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 1240 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16091155)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16601982
GRCz11 2 16270572
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTGTGAAGTCRTTGAATCCTTGGGAGTTTTATCAAAACATGCTGACAATT[T/A]GAACTTCGAAAATAACGAAAGACTAAATTTCAAAACACAGGACTTAAATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39798
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 1300 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16090976)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16601803
GRCz11 2 16270393
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGCATCAGTGCACGATTAGCAATTCACCCTCAGACCTGCAGGTTAAAACT[C/T]AGCAGAGTTGGCCAGTATTACAAATACACACCGAAAAAGACGATTACTCA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39797
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 1371 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16090761)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16601588
GRCz11 2 16270178
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGAAGCTCGGAAGGTTGTATCAACTGAAGGTGTATTTACTAGAGGTTG[T/A]ATCAACACCAAACTTTTTGATGGCAAAAGTGTTGACATTGTAGGAGGACC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19710
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 1576 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16090148)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16600975
GRCz11 2 16269565
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAAATAATAACATTAAAGCCATTACTTTAGAAGAGTGTGCCTCGGGAGTA[C/T]AAATGTCATTGCCTAGTTCATTGCAGAAATACAGTAGGTTTACAAATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17428
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 2133 3063 3 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16088477)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16599304
GRCz11 2 16267894
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACGAAGCAGAACTTTGCAAAAGAACTCNNNCTGTTCCTGGGACGGTCTGTGAC[A/T]AGTGCATAMATCAGAGCCAAATTGATTGTGYYTTCTGTGCTTATCAGAAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39796
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Essential Splice Site 2488 3063 5 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16083257)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16594084
GRCz11 2 16262674
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGTTGGGCTGGACTATCTGGGCTGGGCTCACCGTGCATCCTTTTCAG[G/T]TAAGGCACATTAGCTTTTAAACCCCACTATACATCGCACCACCACCTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa12665
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 2502 3063 6 16
ENSDART00000133708 None None 665 None 10
Genomic Location (Zv9):
Chromosome 2 (position 16077693)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16588520
GRCz11 2 16257110
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGCTCTCCACAGAAACGAACCTCAGCGCMCCGGAAAAAGAGGCACATGGA[C/T]AGGTYGCACCTCTCGGTGAGTTTACTTTCTCAGCTAAATCTTGANNNNNAACACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19709
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000057216 Nonsense 2984 3063 14 16
ENSDART00000133708 Nonsense 542 665 9 10
Genomic Location (Zv9):
Chromosome 2 (position 16027325)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 16538152
GRCz11 2 16206742
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTGGCTGAGAGCCTTCACAGATGAGCGGGAGCAGGTCCAGCATGACCTC[G/T]AGACAGGTGAACGGCGCTTCTGGAGCTGTATAAAAACACTGCTTTTGCTG
Associated Phenotype:
Not determined