Busch Lab

ZMP

slc4a1

Ensembl ID:
ENSDARG00000012881
ZFIN ID:
ZDB-GENE-010525-1
Description:
solute carrier family 4, anion exchanger, member 1 [Source:RefSeq peptide;Acc:NP_938152]
Human Orthologue:
SLC4A1
Human Description:
solute carrier family 4, anion exchanger, member 1 (erythrocyte membrane protein band 3, Diego blood
Mouse Orthologue:
Slc4a1
Mouse Description:
solute carrier family 4 (anion exchanger), member 1 Gene [Source:MGI Symbol;Acc:MGI:109393]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa17733 Nonsense Available for shipment Available now
sa30830 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40044 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa33146 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa17733
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020253 Nonsense 131 876 7 19
ENSDART00000029386 Nonsense 143 905 7 21
ENSDART00000122181 None None 234 None 7
ENSDART00000124326 Nonsense 143 905 8 22
ENSDART00000125293 None None 398 None 9
Genomic Location (Zv9):
Chromosome 3 (position 19971183)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19932158
GRCz11 3 20081898
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATTGTGGCTGTAATCAGGGGCYGTGCTGCTGGATGTTGAWGACAGCAGTT[T/G]ATCCAGCATTGRCCAGAAGATGGTGGAACAACTTCTGCTCAAAAAAGAGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa30830
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020253 Essential Splice Site 315 876 9 19
ENSDART00000029386 Essential Splice Site 344 905 11 21
ENSDART00000122181 None None 234 None 7
ENSDART00000124326 Essential Splice Site 344 905 12 22
ENSDART00000125293 Essential Splice Site 105 398 4 9
ENSDART00000020253 Essential Splice Site 315 876 9 19
ENSDART00000029386 Essential Splice Site 344 905 11 21
ENSDART00000122181 None None 234 None 7
ENSDART00000124326 Essential Splice Site 344 905 12 22
ENSDART00000125293 Essential Splice Site 105 398 4 9
Genomic Location (Zv9):
Chromosome 3 (position 19967519)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19928494
GRCz11 3 20078234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGACAGAGTCCGCCCATATGACACTCGAATCATGGTTGGGGGCAAAGG[T/G]CAGCTTTTTTATAGCATTTACCATGTGCAATTACACTGTTAAAAGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40044
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020253 Essential Splice Site 315 876 9 19
ENSDART00000029386 Essential Splice Site 344 905 11 21
ENSDART00000122181 None None 234 None 7
ENSDART00000124326 Essential Splice Site 344 905 12 22
ENSDART00000125293 Essential Splice Site 105 398 4 9
ENSDART00000020253 Essential Splice Site 315 876 9 19
ENSDART00000029386 Essential Splice Site 344 905 11 21
ENSDART00000122181 None None 234 None 7
ENSDART00000124326 Essential Splice Site 344 905 12 22
ENSDART00000125293 Essential Splice Site 105 398 4 9
Genomic Location (Zv9):
Chromosome 3 (position 19967519)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19928494
GRCz11 3 20078234
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CATGACAGAGTCCGCCCATATGACACTCGAATCATGGTTGGGGGCAAAGG[T/G]CAGCTTTTTTATAGCATTTACCATGTGCAATTACACTGTTAAAAGTGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33146
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020253 Nonsense 811 876 18 19
ENSDART00000029386 Nonsense 840 905 20 21
ENSDART00000122181 Nonsense 169 234 6 7
ENSDART00000124326 Nonsense 840 905 21 22
ENSDART00000125293 None None 398 None 9
Genomic Location (Zv9):
Chromosome 3 (position 19956126)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 19917101
GRCz11 3 20066841
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCAATACATCTATCTGTTTCTTTGTAGGTGCCAACTATGCGTATGCACT[T/A]GTACACTTTGATCCAAGTGATGTGTTTGGCGTTGCTGTGGGTGGTAAAAT
Associated Phenotype:
Not determined