Busch Lab

ZMP

asah2

Ensembl ID:
ENSDARG00000012829
ZFIN ID:
ZDB-GENE-041112-1
Description:
Neutral ceramidase [Source:UniProtKB/Swiss-Prot;Acc:Q5W7F1]
Human Orthologues:
ASAH2, ASAH2B, ASAH2C
Human Descriptions:
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2 [Source:HGNC Symbol;Acc:18860]
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2B [Source:HGNC Symbol;Acc:23456]
N-acylsphingosine amidohydrolase (non-lysosomal ceramidase) 2C [Source:HGNC Symbol;Acc:23457]
Mouse Orthologue:
Asah2
Mouse Description:
N-acylsphingosine amidohydrolase 2 Gene [Source:MGI Symbol;Acc:MGI:1859310]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa27879 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa27879
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027793 Nonsense 204 743 5 20
ENSDART00000146650 Nonsense 204 743 6 21
Genomic Location (Zv9):
Chromosome 12 (position 6809070)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6091990
GRCz11 12 6125574
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTATTGATATTGCTCATAGGAATTTGAGGCCTGGACGAATATTCATAAAT[A/T]AAGGACAAGTAGCAGACAGCAACTTCAACAGAAGCCCACATTCATACATG
Long Flanking Sequence:
GGCCAGACAGAATCTGGGGACATTTTTTGCTATTTCTGCTGAGAATTTTGTAAAAAAAAAAAAAAAATCTGCAGAATGATTTTATCATAACTAAAAACTTAACACATGAAATAATAAATAATACCTTTTTAACTTTTATTTGATGTTTACTATGCGAATTCAATTAGATCCACTTATTTGGTAAACAAAGCAAGTCTCTCGTATAATAGATTTACTAAAAGACAGAAAATAGTACTTAACAAAATGTATTGTAAACAAATCATATGAACATTATCATATTAGTCAATGATATTACTGAAATTAATTTAAATTAATAAATTTATTTACACACATTTACACAAGAAAATAAATAGACTCATTGATGGTTTTAAAAATCTACATAATACTACAAATTCCTCATGTAAATGGTTTCAGCGGTCACTGATAATATTTTCTATCCTCTGTATCAGAGTATTGATATTGCTCATAGGAATTTGAGGCCTGGACGAATATTCATAAAT[A/T]AAGGACAAGTAGCAGACAGCAACTTCAACAGAAGCCCACATTCATACATGAACAATCCGGAAGAGGAGAGAAACAGGTCTGTTTGTTTTTACTATATGAATATATACTTTGTAAATTGTCGGATGAATAAAAAAATCTCATAAGTGACAGAAATCAAACTATTAAGGGCAAACATTTGCATTCTGAAAAAAAAAATCTTAAAGCTAATAATATTGACCTTAGTTTTATTTATTATTATTATTATTATTTTATTATTATTATTGTTGTTAATATTATTAGTATAGGAGGACATTTGCATTCAGAAAAAAATCTTCTTAATTCCGTTATTTATTTATTTATTTCATTTTTATCTAATAATTTAATTTAATTTTTTACAATTGTTTACTTTTTTTATTCCAGCAATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATATGAAATACTGTTAAATTTTCTTTGCTCT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa2672
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000027793 Nonsense 589 743 17 20
ENSDART00000146650 Nonsense 589 743 18 21
Genomic Location (Zv9):
Chromosome 12 (position 6820368)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 6103288
GRCz11 12 6136872
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AATGAACAAATCTCCCACAGGGGACAATAGGAGAKCTGCCAAAGGGWCCC[G/T]AACCCCCTTTCTTTGATGAAGACAAACTTTTTAATCAAGTAAGAGACCCG
Long Flanking Sequence:
CCGCCGCTCAGCCAAGGGAATGCAGACCTCTACAACAGTGGTTTGATCTGTAGCCTTATTATCTAAAAAGATAATAATAATAAAAAAACGTACTTAACATAAACATTAACCTTAGCAGTTTTATTTATTCATTTAAAAAAAAATATTTCGGCCAAACTAAAAAAAACTAAATACTAAAACACTGAGAAATATTTGACAAAAGATGAAAACTTCACAGCAGGGCTCACAATTTTGTCTTCAACTGTATCTGTGCTATCTTTTCAAATGATTTTCCCCCGACTCTCTTAGATCCAGCGATATGAAGGAGCATCCACCATTTTTGGCCCTCACACTCTCTCCGCGTACATCCAGCGCTACAGAGGCCTGGCCAAAGCCATAGCTCATGTAACTCTCCACCTTTAATTCATTTGCATATTTCTGATGAATTTAAATGATCTGGCTGATCTCATGAATGAACAAATCTCCCACAGGGGACAATAGGAGAGCTGCCAAAGGGACCC[G/T]AACCCCCTTTCTTTGATGAAGACAAACTTTTTAATCAAGTAAGAGACCCGGTGGCAGATGTAGCACCAGTTGGCACCACCTTTGGAGATGTCTTGCAGGAGGTTAACCCTGTCTACAAAGTGGTAAGTCAATACTGTACTGTAATAAGGTCACATTTTGCTATATATCAAGGACAAAATCCAATCATCTCAATACAAATTCACAGATTGGGGAGATCTTTTGTTTTTTTTGTTTTTTTCAAAAAAAGCTTGCCACAGATTTTACTCAAGTAAAATTTCCTTTTACTTGACTTTTTACTCTATTTTATTTAAAATATATAATCTCAAGTGTTTTGTTGTGGAATGTATTGTATATGTTTACTATTATTTTGGATTCGTGACACAAATTTGCATAACAAGTAGTAAAAAGTCGTAATTGTTTAAGTTAACTTTTACTGTAAAAAAAATCCGTAAAAAAACTGTAAAATTACGGCCTTTAAAATACAGAAATATACCGTAAAA
Associated Phenotype:
Not determined