Busch Lab

ZMP

mettl3

Ensembl ID:
ENSDARG00000012827
ZFIN ID:
ZDB-GENE-030131-9498
Description:
N6-adenosine-methyltransferase 70 kDa subunit [Source:RefSeq peptide;Acc:NP_997945]
Human Orthologue:
METTL3
Human Description:
methyltransferase like 3 [Source:HGNC Symbol;Acc:17563]
Mouse Orthologue:
Mettl3
Mouse Description:
methyltransferase like 3 Gene [Source:MGI Symbol;Acc:MGI:1927165]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa20914 Essential Splice Site Available for shipment Available now
sa1579 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa20914
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019699 Essential Splice Site 246 584 3 11
Genomic Location (Zv9):
Chromosome 7 (position 23052833)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21618018
GRCz11 7 21884356
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGAAAGTCTACTGAGCCAGCAATCCACTAAGGAACAGCAAAGCAAAAAGG[T/C]ATAATAATGAAGCAAAACAGCATGCTAAAGCCACTGTGATTTAAATGTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1579
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000019699 Nonsense 533 584 10 11
Genomic Location (Zv9):
Chromosome 7 (position 23045365)
Other Location(s):
Assembly Chromosome Position
GRCz10 7 21610550
GRCz11 7 21876888
KASP Assay ID:
554-1522.1 (used for ordering genotyping assays)
KASP Sequence:
ATAAACCAGATGAGATCTATGGAATGATTGAGCGCCTGTCTCCAGGCACA[C/T]GAAAGATTGAATTGTTTGGCAGGCCACACAATGTACAACCTAACTGGTGA
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461