Busch Lab

ZMP

itga3b

Ensembl ID:
ENSDARG00000012824
ZFIN ID:
ZDB-GENE-050411-55
Description:
integrin, alpha 3b [Source:RefSeq peptide;Acc:NP_001177238]
Human Orthologues:
ITGA6, ITGA7
Human Descriptions:
integrin, alpha 6 [Source:HGNC Symbol;Acc:6142]
integrin, alpha 7 [Source:HGNC Symbol;Acc:6143]
Mouse Orthologues:
Itga6, Itga7
Mouse Descriptions:
integrin alpha 6 Gene [Source:MGI Symbol;Acc:MGI:96605]
integrin alpha 7 Gene [Source:MGI Symbol;Acc:MGI:102700]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa22024 Nonsense Available for shipment Available now
sa35203 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31854 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa22024
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105884 Nonsense 546 1041 12 26
Genomic Location (Zv9):
Chromosome 12 (position 6175251)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5576074
GRCz11 12 5611031
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCACGTTTACAGGCCTTCTGTCTTTCTCTGCTTCTTCCTGTCAAGAGCTG[G/T]AGCTCAGTGTTAATGTGAGAGTCTATGATCACACTGTACACATTCTTTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa35203
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105884 Essential Splice Site 737 1041 18 26
Genomic Location (Zv9):
Chromosome 12 (position 6183532)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5567793
GRCz11 12 5602750
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AATCAATGCGCTATATGGTCACTGACAGTGATGATGTTTGTTTGTCTTCA[G/A]TATTAGTGAACAGGCGGATCTGTTTCCTGTTCTTGTCACCCTCAATGTGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31854
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000105884 Essential Splice Site 763 1041 18 26
Genomic Location (Zv9):
Chromosome 12 (position 6183612)
Other Location(s):
Assembly Chromosome Position
GRCz10 12 5567713
GRCz11 12 5602670
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTTGTCACCCTCAATGTGAAGAACACGATCCTCACTACATTTTCTTTG[T/C]ACGTACTTTGATGTTATTAACAATAAAACAATCTGTGTGCATTTACATTT
Associated Phenotype:
Not determined