Busch Lab

ZMP

arl13b

Ensembl ID:
ENSDARG00000012763
ZFIN ID:
ZDB-GENE-021217-3
Description:
ADP-ribosylation factor-like protein 13B [Source:UniProtKB/Swiss-Prot;Acc:Q8JHI3]
Human Orthologue:
ARL13B
Human Description:
ADP-ribosylation factor-like 13B [Source:HGNC Symbol;Acc:25419]
Mouse Orthologue:
Arl13b
Mouse Description:
ADP-ribosylation factor-like 13B Gene [Source:MGI Symbol;Acc:MGI:1915396]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa25614 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa17422 Nonsense Available for shipment Available now
sa25615 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa25614
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102184 Essential Splice Site 162 407 4 10
ENSDART00000122316 Essential Splice Site 162 261 4 5
Genomic Location (Zv9):
Chromosome 1 (position 33315606)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32950357
GRCz11 1 33682925
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTGTCATTGGAGAAGCTAGTCAACGAAAATAAATGCCTTTGCCAGATTG[T/A]AAGTTAATATTTCATCACAATTTATTATAACCGGAGTCTGGTTTGATAAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17422
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102184 None None 407 None 10
ENSDART00000122316 Nonsense 249 261 5 5
Genomic Location (Zv9):
Chromosome 1 (position 33316043)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32950794
GRCz11 1 33683362
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGCTTACWAAACTKCAGATTGTTGCTGCTTAAMGCCTGGTTTATRCTCTA[C/A]GYGCCAGCTWGTTYGCTTGAGTGCGTGCAGCGAATGTGACGTCATCRCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25615
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000102184 Nonsense 270 407 7 10
ENSDART00000122316 None None 261 None 5
Genomic Location (Zv9):
Chromosome 1 (position 33319787)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 32954538
GRCz11 1 33687106
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GGCGAACTCATTAGAATGCAAATACTCACTTTATATAAAAATTCCAGAAC[C/T]AAGACAGACTAAACAGAGAAAAAGAGATGCAAAGACAGAGGGAAAATGGC
Associated Phenotype:
Not determined