Busch Lab

ZMP

agl

Ensembl ID:
ENSDARG00000012709
ZFIN ID:
ZDB-GENE-071004-6
Description:
amylo-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:RefSeq peptide;Acc:NP_001166124]
Human Orthologue:
AGL
Human Description:
amylo-alpha-1, 6-glucosidase, 4-alpha-glucanotransferase [Source:HGNC Symbol;Acc:321]
Mouse Orthologue:
Agl
Mouse Description:
amylo-1,6-glucosidase, 4-alpha-glucanotransferase Gene [Source:MGI Symbol;Acc:MGI:1924809]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa7491 Missense Mutation detected in F1 DNA Not yet available
sa10885 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7491
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007766 Missense 182 1539 4 33
Genomic Location (Zv9):
Chromosome 2 (position 20248312)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20820922
GRCz11 2 20478894
KASP Assay ID:
554-4300.1 (used for ordering genotyping assays)
KASP Sequence:
GACGCTGGGTGAGTCTCGCTCCTGTTACTCTCTGGCWGATCAGCTGGAGC[T/C]CAACCCAGACTTCTCTCCTTCGGGACAAACGTACACCTGGACAGATGCTG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa25794
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007766 Essential Splice Site 581 1539 12 33
Genomic Location (Zv9):
Chromosome 2 (position 20266097)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20838707
GRCz11 2 20496679
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGGATAATGTCTTTGTGACTAGATTAGGAATCACTTCACTTATCAGAGG[T/G]ACGGCCTTTCAGTAACCCTGGCTGTTTTGTTATGTTTTGCTTTAACATGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa10885
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007766 Nonsense 1229 1539 26 33
Genomic Location (Zv9):
Chromosome 2 (position 20287488)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 20860098
GRCz11 2 20518070
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGAGCGCCACATRCAGGGTATWGAGTTCAGAGAGAGSAATGCCGGACCA[C/T]AGATTGAYCGYAACATGAGAGAYGAAGGTACAGTAAAGCCTTTTTAATAG
Associated Phenotype:
Not determined