Busch Lab

ZMP

si:ch211-55i2.1

Ensembl ID:
ENSDARG00000012699
ZFIN ID:
ZDB-GENE-091204-306
Human Orthologue:
BBX
Human Description:
bobby sox homolog (Drosophila) [Source:HGNC Symbol;Acc:14422]
Mouse Orthologue:
Bbx
Mouse Description:
bobby sox homolog (Drosophila) Gene [Source:MGI Symbol;Acc:MGI:1917758]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa8933 Essential Splice Site Mutation detected in F1 DNA Not yet available
hu7857 Nonsense Available for shipment Available now
sa6137 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa8933
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Essential Splice Site 139 906 None 24
ENSDART00000137008 None None 129 None 2
ENSDART00000137964 None 139 139 None 3
ENSDART00000139994 None None 317 None 4
ENSDART00000142476 Essential Splice Site 139 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29184078)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28615672
GRCz11 10 28502297
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
YGTAYTGGACCCCAAAGAAAAGCAGAAATACACAGACATGGCCAAGGAGG[T/A]AARAACTAACCAACACACACGACTCAATTGAAYGATTAGCTAACATAAAG
Long Flanking Sequence:
TTTTATATATGTAAAATTCAAATATTAACTGTCATTTATGTAACTTGCACATATTTCTAGATTTCTACAAGGGAAACAGCCATTGACTAATTCTGGCAAATTGTATATTCTGTATTATTAATGTGCATAGTCTTTGTCAAATACACCTGAACATTTTTATTTTGATCTAAAGTGGGCTTATTCCACTGACTATATCTCCATATTTCTCTGTCCACCTTTTCTGCACTCGTCTTCCCCTCAGGAGCCGGTGTTATGTGCGGAGAGCAGTGTTCAGGAGGGAGAGTGTGGCGGGATGGAGGATGACAGTGAAGAATACTCCTCTGAACAGCGGGCTCGGCGGCCCATGAACGCCTTTCTGCTATTCTGCAAACGCCATCGCTCGCTGGTCCGTCAGGAGCATCCACGATTAGACAACCGAGGAGCCACTAAAATCCTGGCCGACTGGTGGGCCGTATTGGACCCCAAAGAAAAGCAGAAATACACAGACATGGCCAAGGAGG[T/A]AAGAACTAACCAACACACACGACTCAATTGAATGATTAGCTAACATAAAGCCAAACTAAAAATTGTTCTGACGCCATTTTCACATTATTACAGTTCTTTTGCTGGAGATTACAAAATGGTAATAAAATATGACGAGCTCATTTTCTTTGCAGTAAACTGTCAGAACAATTGATAATGTAAGATAACTTTGATTGAAAGGTACAGTATGTAATAGGGGTTAAACGACTTTACGATTTTTAAAGTCGACTTTTATTTTATTAAAGTCTAGTCAACGTTGACTAGTCAAAGAAAAGTTGCCTATAGCTGGAACAAACAGAAACTTGACAGCTCTGCTGCTTAAGAAATATGACTGAAAACTGAGGCTGCGTCCGAAACCGCATACTTCCATACTATATAGTACGCTAAAATCAGTATGTGAGCCAAGTAGTATGTCCAAATTCATAGACTTCGAAAATCAGTATGCGAGAAGTATCCAGATGACTTACTACTCCCAGCGAGAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27624
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Nonsense 272 906 8 24
ENSDART00000137008 None None 129 None 2
ENSDART00000137964 None None 139 None 3
ENSDART00000139994 None None 317 None 4
ENSDART00000142476 None None 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29175960)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28607554
GRCz11 10 28494179
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTATTATTAAAATACGGTTTAAATCATTTAAAAATCTAATTCAGTTTGT[C/T]AATCTTCGTAAACACCATATTGCCTTTCGGTTCCTCTAATCTGATTTGAT
Long Flanking Sequence:
GCCACAGCGGAATGAACCGCCAACTTATCCAGCATATGTTTTACACAGCAGATGCCCTTCAAGCTGCAACCCAGTACTGGGAAAAATAAGAATTATAATTAAATTATTCAGAATTGTGGAATCATTTATGGTTAAAAAGAAAATATTGTTGTTGTTGTTTTTTGGAGTAAAGCAGAAAATAAAGCTTAGAAATTACATTAAGAAATCAATTAAATTGTATTAAAATAATATGTATTATTATGGATTTTAATTGCATATTAGAAATATACTACAGTTATATTGTTTTCAATCAAAATAATATATTGCATTATTTATTTTTTGATGCATTTCAGTTGCATAAAAGAAAAAAATCTAAACTTTAAATAATCGGTGTGCAGCTACTTTTTAAAAATGACAAAAGTAAAGAAGGGAAAGATCAGTAAATTCTATTGTTTTATTTTATTATATAATTTTATTATTAAAATACGGTTTAAATCATTTAAAAATCTAATTCAGTTTGT[C/T]AATCTTCGTAAACACCATATTGCCTTTCGGTTCCTCTAATCTGATTTGATGTTTAAAGGCATGCTTTTTTTCTGTAATATGGTAACAACCAGTACAGCGAAGAAACGGCAACATGGCGGCAACATCCAATTATAAGGCTAAAAGAAAATGTCTGTTTCTAAAGTCTTGGAAGCAGACATTGTGGGAACAACACGACAAAAAAATGAAGTGATGTTTTGCACAATGTGCCGTCCGTTTGACAAGTCAGCCACCTTTTGTTAAATAATTTCGAACTGCTATAAAATACCTCCACATTTTCCATACTGCTCTTTTTGTTTGCATAAAACTTTGAATTTCGCTCATTATACGTTTATCCACATTTTTTAAGTATTCAAATTCTAGATTCACAGACGTTATTTTTGACACATTATTTAAAATATGTGGCTAAAAATAGCTATTAACTTCTCTTCCCTTTTTTTTATTTTTATTTTATTTGGTGGGGCCAGTAGAAATTTTGGCAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
hu7857
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Nonsense 313 906 9 24
ENSDART00000137008 None None 129 None 2
ENSDART00000137964 None None 139 None 3
ENSDART00000139994 None None 317 None 4
ENSDART00000142476 None None 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29174558)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28606152
GRCz11 10 28492777
KASP Assay ID:
554-2411.1 (used for ordering genotyping assays)
KASP Sequence:
AGCACACTGGGAAATCAGCCCTTTTCCAGCTGGCTGAGGTGAGATTACCT[A/T]AAAAACTTGTCTGTCAGACCCATAAWACCCTACTTAGSSNCKRRRACGTYT
Long Flanking Sequence:
CTATAATATATATAATATTATATATATTTTTAATCTGAATATTATTAAAGCTATAATTATGTTTATTTGAAATACTACTAAAATAGCCTAAGTCAGTGGATTTCATTAAACAAAATGTTGACATAATCATTTGTATGTTTTTCCATTGCTGATGCTTAGTTTTCAAGCACAGCTCATCTCCAGTCACGTTATCTGTCACTTCCTGTTTAGACAGCGTAATTGATGGCTATATATATTTTTTATTTTATTGACTCTACCTGTGGCTTTTCCATCAAACTGTCAACAGAGGGAGGTGTTGAGTTGTAAATGCCAGCGGTCGCTTCAAGGCGAATGTTGATTTAAGATTGTTTGTTTATGGCTTGTTCTACTCCACTGATTTCATTTCTTTATTTTTTGAATGCTTTCAGATTTCCTCCAGCTCTTCCCAGACTGGATGCACAGATGTTGCTAAGCACACTGGGAAATCAGCCCTTTTCCAGCTGGCTGAGGTGAGATTACCT[A/T]AAAAACTTGTCTGTCAGACCCATAAAACCCTACTTAGCGCTGAGACGTCTCAGATACGGATGGTTGCCTGTGAACGTGTAAATGATTTGCTTAATGATCTGAACGTGTTTTGTTGGACTTCTTCTCAGATTTCTTCCAGTCCAGCACAGTCAGCTGGAGGAAGTAAGAATGCAGAGGACACAAGCTCACTTACACATGTAGAGGTGAGGGACAGTCAAAGCTTTTATAGTGAGTTCTTTAAATTACATCTGAACACTGATTATGTTTACTTTTATGACCTCCTTAGGCTTCTGGACCGTCTCAGCCAAGCTCACCAGACCTGCCCAAGAGTTGTGTTAAATCACCCCTGTTTCAGCTGGCTGAGGTACAGTACTAAACTAATTTAACATGAGTTTTTGTGATCCAATCCAAAGGGTCAGCTGTAGTTAAGGTTTAAGGTTATGACGGTATAATAACAATATCACGGTTTCATGATATTGTGATCACTGCTTTAAAATATG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6137
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000018788 Essential Splice Site 381 906 10 24
ENSDART00000137008 None None 129 None 2
ENSDART00000137964 None None 139 None 3
ENSDART00000139994 None None 317 None 4
ENSDART00000142476 None None 229 None 6
Genomic Location (Zv9):
Chromosome 10 (position 29172982)
Other Location(s):
Assembly Chromosome Position
GRCz10 10 28604576
GRCz11 10 28491201
KASP Assay ID:
554-3767.1 (used for ordering genotyping assays)
KASP Sequence:
ATTTCTTGTGTTGAAAAGGCATCTYTGGATACCTTTCTTTTCTTTGGATA[T/A]AAAGTAAGCAACTNNNNTGTTCAGGTCTATAACATTACAAATGTCTGCTS
Long Flanking Sequence:
AAGCCTGGTATTTAGTGCGATATGGTGCTATACAGTGCTAAAGTCTAATATCTCCAGATTGGCTTTAGTCTTGACTAGTGCGGTTGAATGACATTTGTTCTGGGAGCACTGTATAAATGTGGCGGCGCTATTGACGCATACTCAGGGTCCGTATGCGATATCTAGTGTATATATCTATGAAAAGCAACAACAAAACACTACATATTTTAATTTAAGAAACATTTAAGATATTTCCCAGTACTGGGTTGCGGCTGGAAGTGCATCCGCTGTGTAAAACATGCACCGGAATAGTTGGCGGTTTATTCCGCTGCGGCAACCTCTAAATAAATAAGGGACTATGCTGTAAGAAAATAATAAAATGAACATTTAAAACATTTACAGTAAACATGTCAGGCTAAATAATTCATGCAAATCCTTGACTTCTGCTGTCTTTGTTAGTTTCAACAACAGATTTCTTGTGTTGAAAAGGCATCTCTGGATACCTTTCTTTTCTTTGGATA[T/A]AAAGTAAGCAACTGCACTGTTCAGGTCTATAACATTACAAATGTCTGCTCAATCGCTGAATTTAATGATCAATATTTTAATAAAAATATATACTACATACATGAGTATAAAAATATATACAAACAGATGCCATGAAAAAATATATATATTGTATAAAAATAGAACAAAAAATCAGATATGCTGTATATGATAGGAATGTCAGCTTTTAATCTTGTCCAGCAACATCACAGCAATTTTGGTCTGAATAGTGTTGTCTTTTGCACCGTTAAGCCCGACCAGTAGCTTTTAATATGGATGGTCCTTTTCTGCTGGAGATACTGTTGCCCTAAAAAAGGTCTTTGACAACATAAAAAAGTTACATATACCATAGTAACATTATGACAGAAGATGGTAATGGTTTTAAAACCTTGACTTTTCCTAACCGTGGTAAACCTTGAAACCAGTTATCATCCCATGCCTAGGTGTGATCATTACCGTTTCCACCTAGTATCAAAGAAACA
Associated Phenotype:
Not determined