Busch Lab

ZMP

atp2b1a

Ensembl ID:
ENSDARG00000012684
ZFIN ID:
ZDB-GENE-030925-29
Description:
plasma membrane calcium-transporting ATPase 1 [Source:RefSeq peptide;Acc:NP_001038222]
Human Orthologue:
ATP2B1
Human Description:
ATPase, Ca++ transporting, plasma membrane 1 [Source:HGNC Symbol;Acc:814]
Mouse Orthologue:
Atp2b1
Mouse Description:
ATPase, Ca++ transporting, plasma membrane 1 Gene [Source:MGI Symbol;Acc:MGI:104653]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa40264 Nonsense Mutation detected in F1 DNA Not yet available
sa33434 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40264
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014257 Nonsense 122 1215 3 20
ENSDART00000077664 Nonsense 122 1228 3 21
ENSDART00000123224 Nonsense 125 1226 2 21
ENSDART00000126958 Nonsense 122 334 3 9
ENSDART00000128079 Nonsense 122 1228 2 20
Genomic Location (Zv9):
Chromosome 4 (position 15164504)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16100357
GRCz11 4 16099112
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGATTATTTTGGAAGTGGCAGCAATAGTTTCTTTAGGCCTTTCTTTTTA[T/A]AAACCTCCAGATGCAGGAGATAAAAGTAAGTAACCTGTTTATTTCCTTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33434
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000014257 Nonsense 420 1215 8 20
ENSDART00000077664 Nonsense 433 1228 9 21
ENSDART00000123224 Nonsense 430 1226 9 21
ENSDART00000126958 None None 334 None 9
ENSDART00000128079 Nonsense 433 1228 8 20
Genomic Location (Zv9):
Chromosome 4 (position 15154451)
Other Location(s):
Assembly Chromosome Position
GRCz10 4 16090304
GRCz11 4 16089059
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTGTTAAGTTTTTCATCATTGGTGTGACCGTACTGGTGGTGGCCGTTCCT[G/T]AGGGTCTTCCGCTGGCTGTTACCATCTCATTGGCTTACTCTGTCAAAGTA
Associated Phenotype:
Not determined