Busch Lab

ZMP

zgc:92006

Ensembl ID:
ENSDARG00000012674
ZFIN ID:
ZDB-GENE-040801-238
Description:
RNA pseudouridylate synthase domain-containing protein 4 [Source:UniProtKB/Swiss-Prot;Acc:Q6DBR0]
Human Orthologue:
RPUSD4
Human Description:
RNA pseudouridylate synthase domain containing 4 [Source:HGNC Symbol;Acc:25898]
Mouse Orthologue:
Rpusd4
Mouse Description:
RNA pseudouridylate synthase domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:1919239]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa27755 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4413
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020283 Nonsense 34 358 1 7
Genomic Location (Zv9):
Chromosome 11 (position 18483982)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17849818
GRCz11 11 17984453
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCRCAGTTTCAGACACCCAGACCGTCGCTTCAAAACACAAAACAGCACCG[A/T]AAGCAGCAGACATCGCCAACAGACTCCGGAAAGAGAAAGAGAAAGAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa27755
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020283 Nonsense 272 358 6 7
Genomic Location (Zv9):
Chromosome 11 (position 18491504)
Other Location(s):
Assembly Chromosome Position
GRCz10 11 17857340
GRCz11 11 17991975
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TATTATGTGTGTTTTAGGTGTGAAAAACCAACTTCGAGTGCACATGGCTT[T/A]AGCGTTGACCTGCCCCATTCTTGGTGACCATAAATATTCCCACTGGAGCA
Associated Phenotype:
Not determined