Busch Lab

ZMP

gtf2e2

Ensembl ID:
ENSDARG00000012672
ZFIN ID:
ZDB-GENE-030131-6794
Description:
general transcription factor IIE, polypeptide 2, beta [Source:RefSeq peptide;Acc:NP_997896]
Human Orthologue:
GTF2E2
Human Description:
general transcription factor IIE, polypeptide 2, beta 34kDa [Source:HGNC Symbol;Acc:4651]
Mouse Orthologue:
Gtf2e2
Mouse Description:
general transcription factor II E, polypeptide 2 (beta subunit) Gene [Source:MGI Symbol;Acc:MGI:1915

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa32665 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa7904
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016488 Nonsense 90 291 4 8

The following transcripts of ENSDARG00000012672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 21638864)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22174031
GRCz11 1 22864770
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
AGATCTAGATGTGACACATCTTTGTCTTTCTCTCTCAGACGAGGCACCAG[C/T]GAGGTGATACTCATCCTCYGACTTTAGAGGAAATTCTGGATGAGACCAAG
Long Flanking Sequence:
GAATACAATTTCCAGAGAAAGACCCAAGGGAATGAAATTATCATGAGCTGAGCAATCCTCACTGTCAATAAAACATATGCTCCTTCCTTAAAATATCATGGGAAATATTATATAATATCTCTGAGCACATCTATTGGCAGTCACAGCAATCCTGTGATCTGTCATGAGTTTTTTTTTTAATTTCTAAAGGTTTACATGTTGTGTGCTTGGAAAAACAGTACCTCTCCTTGCTCTCTGAACTTGCTCTCTGTTTTTTTCCTAACTATATAAATATTCTGTGAAAATTCACACTACTAAAACACATCGTCATTTTACACTTGTTTAATATTATCGTAAGCAGGGTGTCTGTCTTTTTTTGTGTGTGTCAGGCTTGGCAGTTCCTCAGTATAATGAAGTACTCTTTCTAACATGACAGTAATTAAAGGCTGTCAAGCTGTAATCCACAGTTGTAGATCTAGATGTGACACATCTTTGTCTTTCTCTCTCAGACGAGGCACCAG[C/T]GAGGTGATACTCATCCTCTGACTTTAGAGGAAATTCTGGATGAGACCAAGCTACTGGACATTGGCATGAAGCAGAAACAATGGCTGATGAGTGAGGTGTGTGCGTGCGCAGAAACATAGCATTCAATTTAATAGTAACTTTGTTTAGGTTAGTCATGTGCATAAAACCTACCCAAACCATCTTCATTTGAAGTTTCCGCACGGCTTTTCATCACTCTCAGCAAGTGTTAGTGGTGTGCTTTGATTATCCTCTTTGATAATGTCATAATTGTTGCTTTAGTGCTGTATGAGCCTATATTTAGCAATGCAAATTCAAACAAACATGATTATTGAGTTGAAAAGCTATTAGAATGCTTATATTAATTGTCTGTATTACATTTATGAAACAAAAAAAACTTATGATTTTTAGAAGAAATGATGGAGGTAAGTAATATCACGCTTTTTATTTGCAAACTATCAGCATGTGAGTTAGATAACTGGTGTATTTATTTTATGAAGTTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32665
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016488 Essential Splice Site 182 291 5 8

The following transcripts of ENSDARG00000012672 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 1 (position 21643785)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 22178952
GRCz11 1 22869691
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACTGGATGATGTTGAAGAGGGGCTACCCAATGCAGCCAAGGCTATTAAAG[T/C]AATACACCATCATGCTGTCACTCATTAGTAACAAAACAAAAAAAAACATT
Long Flanking Sequence:
CTTTACAGATATTGCTGTATGTAAAATTGAAAATGTATGTAAATTTTTTTTTCTTTTAAAATATATTTATAAGGCCACAAAGAGTATGGGATAGCTATGTTCCTGTGGTTTTAAATTATTATTTTTATGTTTATGTTTTTTTATTCCAGAATATTATTATAATTATATAATACTTGGATTTATATGCTGCAGAATACTTTTATTGACCAATGTTCCAACAAGCAATGTAATGACACGCAATATATGTTTTCAAGGGCAAGATCGACATTCGAACAAGAATTCAGCATGTAACCTTTCCCTCTCTCCTTCCCTCCAGGCATTAGCAAGTAATCCTAAGATTGATGTGCGGGAAGGGAAATATGCCTTTAAACCCAAGTATCATCTGAAGGATAAGAAAGCTCTGCTTAGACTTCTGGACAAACACGATCAGCTTGGTCTCGGAGGAGTGTTACTGGATGATGTTGAAGAGGGGCTACCCAATGCAGCCAAGGCTATTAAAG[T/C]AATACACCATCATGCTGTCACTCATTAGTAACAAAACAAAAAAAAACATTTACTAAACCGTACATTTAAAGGGGACCTGATATGCCCCTTTTTACAAGATATAAAAGAAGTCTCTGATGTCCCTAGAGTGTATATGCAAAGTTTTGGCATCTTATAACCCATGAATAATTTTTTTAGTTCTTTGAAACTGCTCCTTTTAGCCTTTGATCCAAACAGTGCTTTTATGGTGACTGTCTCTTTAAAATCAAATGAGTATGTACTCCCAGCCCTCCTTTCAAAAGAGTGCAGAGCTACAGACAACCATCACCATTCCATCATTAGTGACTGCATCTCACTTAAAACTGTTTATGCTAATAATGGAGAGATTGTCACTAATGGGCGGGGCTTTCCCCCTCTGATGTACAAAGGAAGAATGTCAGACAGTGTTTCTGCAGACTGCTTTTATGAAGTGTGATTAAAATGAAATTAATTAATGATTTTGTACAGTTGAAATCTGGCTA
Associated Phenotype:
Not determined