Busch Lab

ZMP

si:ch211-199m3.9

Ensembl ID:
ENSDARG00000012656
ZFIN ID:
ZDB-GENE-041014-328
Description:
cyclic AMP-dependent transcription factor ATF-6 alpha [Source:RefSeq peptide;Acc:NP_001103989]
Human Orthologue:
ATF6
Human Description:
activating transcription factor 6 [Source:HGNC Symbol;Acc:791]
Mouse Orthologue:
Atf6
Mouse Description:
activating transcription factor 6 Gene [Source:MGI Symbol;Acc:MGI:1926157]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa23750 Nonsense Available for shipment Available now
sa1154 Nonsense Available for shipment Available now
sa37085 Nonsense Available for shipment Available now
sa43484 Nonsense Mutation detected in F1 DNA Not yet available
sa37084 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa23750
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 177 653 6 16
Genomic Location (Zv9):
Chromosome 20 (position 33884530)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33957043
GRCz11 20 33859922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCACAGCCAAACCTCTCCAACCAGCAAAAAGACCCATCCAGGTGTGCCCC[A/T]AGGTTTCCATTCAGCCTAAACCAATCATTACAGCTGTTCCCATCTCCCGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1154
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 428 653 11 16
Genomic Location (Zv9):
Chromosome 20 (position 33862048)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33934561
GRCz11 20 33837440
KASP Assay ID:
554-1065.1 (used for ordering genotyping assays)
KASP Sequence:
TGTTGTTAAACTTTCCTGGCTTTAACATGACTTTTGTCTTTCTCATAGGT[T/A]GGAGGAGGGGGTTTCAGAGCAGAAGGCATTGATGGTGGTCAAGGATCCTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa37085
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 446 653 11 16
Genomic Location (Zv9):
Chromosome 20 (position 33861993)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33934506
GRCz11 20 33837385
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GAGGGGGTTTCAGAGCAGAAGGCATTGATGGTGGTCAAGGATCCTCTGTA[T/A]TTCAGAACTCCACCCCCCTGCCAGCCACCTGTCAACAGGACCAAGTGCAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa43484
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Nonsense 503 653 13 16
Genomic Location (Zv9):
Chromosome 20 (position 33856622)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33929135
GRCz11 20 33832014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATAACGTGACATTTTTATTTTCCTCTGTCCAACAGAAAGCGTCAAGTAAA[C/T]AAGCTGACGTACCACAGATAATGTCACAGATCCAGTACACAGACTCCTCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa37084
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000007700 Essential Splice Site 521 653 13 16
Genomic Location (Zv9):
Chromosome 20 (position 33856565)
Other Location(s):
Assembly Chromosome Position
GRCz10 20 33929078
GRCz11 20 33831957
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACGTACCACAGATAATGTCACAGATCCAGTACACAGACTCCTCTGAAAAG[T/C]AAGTTTTCTTCGAGAAGCTATGTTTTACCTTCATTTTACATGGTGTAAAT
Associated Phenotype:
Not determined