Busch Lab

ZMP

si:ch211-266d19.4

Ensembl ID:
ENSDARG00000012642
ZFIN ID:
ZDB-GENE-091204-74

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa44071 Nonsense Mutation detected in F1 DNA Not yet available
sa24432 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3277
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106569 Essential Splice Site 389 1055 5 12
ENSDART00000132530 Essential Splice Site 389 1025 7 11
Genomic Location (Zv9):
Chromosome 24 (position 2360842)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2330840
GRCz11 24 2326884
KASP Assay ID:
554-3354.1 (used for ordering genotyping assays)
KASP Sequence:
TTTTCAAAGTTTGCATCATTTAAAAATCCCCTTAATGCATTTCTTCCAAC[A/G]GAGTGTTTGAGTGTTGCAGAAAGGAAGCGCTTCACCTGTCCGTTCTGCGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44071
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106569 Nonsense 797 1055 8 12
ENSDART00000132530 Nonsense 797 1025 10 11
Genomic Location (Zv9):
Chromosome 24 (position 2365310)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2335308
GRCz11 24 2331352
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCTTTCGCTGGAGGAGGAACCTGATCTCACACCAGAGCACCCACCCGGGA[C/T]AAAACCCTCTCCAGTGTTCAATGTGCGATCAAACGTTCATCTCTGAGGCT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa24432
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000106569 Nonsense 1001 1055 9 12
ENSDART00000132530 Nonsense 1001 1025 11 11
Genomic Location (Zv9):
Chromosome 24 (position 2368234)
Other Location(s):
Assembly Chromosome Position
GRCz10 24 2338232
GRCz11 24 2334276
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTGCGCATCTGTCTGTTCATCTGCGCAGTCACACGGGGGAAAAGCCCTA[C/A]CAGTGTCCCATATGCCTCAAGTTCTTCGCCCATTCGTCCTCCATGAAGAA
Associated Phenotype:
Not determined