Busch Lab

ZMP

zgc:66109

Ensembl ID:
ENSDARG00000012610
ZFIN ID:
ZDB-GENE-040426-1538
Description:
S-arrestin [Source:RefSeq peptide;Acc:NP_956853]
Human Orthologue:
SAG
Human Description:
S-antigen; retina and pineal gland (arrestin) [Source:HGNC Symbol;Acc:10521]
Mouse Orthologue:
Sag
Mouse Description:
retinal S-antigen Gene [Source:MGI Symbol;Acc:MGI:98227]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa11585 Nonsense Available for shipment Available now
sa7528 Missense Mutation detected in F1 DNA Not yet available
sa15523 Essential Splice Site Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa8074
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025788 Nonsense 53 392 4 15
ENSDART00000145035 Nonsense 53 392 5 16
Genomic Location (Zv9):
Chromosome 2 (position 5141998)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5587726
GRCz11 2 5499608
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GATCATTCAGACAWACTATAACMAGASTCTCTGTGTCGTCCTCCAGCATA[T/A]GTCACATTGTCRTGCGTGTTCCGGTATGGCCGTGATGACGACGCAGAGGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa11585
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025788 Nonsense 155 392 6 15
ENSDART00000145035 Nonsense 155 392 7 16
Genomic Location (Zv9):
Chromosome 2 (position 5138217)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5583945
GRCz11 2 5495827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CACAGCACTGTGCTGTTGAGTTTGAGGTGAAAGCCTTCTGTGCTGAGAGC[C/T]AGGATGCCAAAGTTCGCAAAYGGTTAGTCTTCATCTTTTTCTAYAACATA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa7528
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Missense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025788 Missense 215 392 8 15
ENSDART00000145035 Missense 215 392 9 16
Genomic Location (Zv9):
Chromosome 2 (position 5134639)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5580367
GRCz11 2 5492249
KASP Assay ID:
554-4299.1 (used for ordering genotyping assays)
KASP Sequence:
ATTATCTTATTTTATTTTTTCCTTGTAGACGTACTATCAYGGAGAACCCA[T/G]CAACRTAAGGGTCAAAATCAATAACCAATCCAACAAAAATGTGAGGAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa15523
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025788 Essential Splice Site 332 392 11 15
ENSDART00000145035 Essential Splice Site 332 392 12 16
Genomic Location (Zv9):
Chromosome 2 (position 5131778)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 5577506
GRCz11 2 5489388
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGGGAATCATGGTGTCTTACAGAGTTGTTGTRAAGCTTATTGTTGGAGGG[T/C]TAGTATTCCCACAACACAATRTAGTCTTCTTATGTATATTCCCACCAAAA
Associated Phenotype:
Not determined