Busch Lab

ZMP

hpx

Ensembl ID:
ENSDARG00000012609
ZFIN ID:
ZDB-GENE-030131-5773
Description:
Hemopexin [Source:UniProtKB/Swiss-Prot;Acc:Q6PHG2]
Human Orthologue:
HPX
Human Description:
hemopexin [Source:HGNC Symbol;Acc:5171]
Mouse Orthologue:
Hpx
Mouse Description:
hemopexin Gene [Source:MGI Symbol;Acc:MGI:105112]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa30920 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa41460 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa31729 Nonsense Available for shipment Available now
sa1444 Essential Splice Site F2 line generated Not yet available

Mutation Details

Allele Name:
sa30920
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506 None None 447 None 10
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506 None None 447 None 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33890284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33046230
GRCz11 9 32856976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCGAATCAGCATCTCGTTTTCTGTCAGCATGGCAACAGATCCACGCGT[G/A]TCCACAGTGCAGCTCCACGGCACGGCGAGTTTCGAGTCCGGTGAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa41460
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506 None None 447 None 10
ENSDART00000020637 Essential Splice Site None 447 1 12
ENSDART00000121506 None None 447 None 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33890284)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33046230
GRCz11 9 32856976
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATCCGAATCAGCATCTCGTTTTCTGTCAGCATGGCAACAGATCCACGCGT[G/A]TCCACAGTGCAGCTCCACGGCACGGCGAGTTTCGAGTCCGGTGAGGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa31729
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Nonsense 52 447 5 12
ENSDART00000121506 Nonsense 52 447 3 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33879954)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33035900
GRCz11 9 32846646
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGAAGGACACAAGCATGAGTTGCACCACGGTGCTCAGCTTGACCGCTGT[A/T]AAGGAATAGAGTTTGATGCAGTCGCCGTGAACGAGGAGGGAGTTCCTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1444
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000020637 Essential Splice Site 247 447 8 12
ENSDART00000121506 Essential Splice Site 247 447 6 10

The following transcripts of ENSDARG00000012609 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 9 (position 33877004)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 33032950
GRCz11 9 32843696
KASP Assay ID:
554-1370.1 (used for ordering genotyping assays)
KASP Sequence:
AAATATCCAAAAGAGGCCCGTGATTACTTCATGAGGTGCCCTCACTTTGG[T/C]AAGTGTATWAATGAGCATGTTAGKAAAGGKGGTAGAGATGGAGCAAGCAC
Associated Phenotype:
Not determined