Busch Lab

ZMP

polr2b

Ensembl ID:
ENSDARG00000012592
ZFIN ID:
ZDB-GENE-041008-1
Description:
DNA-directed RNA polymerase II subunit RPB2 [Source:RefSeq peptide;Acc:NP_001019632]
Human Orthologue:
POLR2B
Human Description:
polymerase (RNA) II (DNA directed) polypeptide B, 140kDa [Source:HGNC Symbol;Acc:9188]
Mouse Orthologue:
Polr2b
Mouse Description:
polymerase (RNA) II (DNA directed) polypeptide B Gene [Source:MGI Symbol;Acc:MGI:2388280]

Alleles

There are 2 alleles of this gene:

Allele Name Consequence Status Availability
sa12802 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa12802
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041408 Nonsense 290 562 7 12
ENSDART00000124865 Nonsense 290 1117 7 25
ENSDART00000128452 Nonsense 290 366 7 8

The following transcripts of ENSDARG00000012592 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 53579122)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51684633
GRCz11 14 52400327
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGCGCTTTAGGAWTYGTGTCTGACAGAGACATTCTGGAGCACATCATCTA[T/A]GACTTCGATGATCCGGAGAKGATGGAAATGGTATGTCACATGAGCGCTGT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28372
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000041408 Essential Splice Site 517 562 12 12
ENSDART00000124865 Essential Splice Site 517 1117 12 25
ENSDART00000128452 None None 366 None 8

The following transcripts of ENSDARG00000012592 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 53583885)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 51679870
GRCz11 14 52395564
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTAGACGTGACCCACAATGTCTGACTGTGTGTGCATTGTGTTTGTTTTTA[G/A]GGTCACGCTGTGGGTCTGGTGAAGAATCTGGCGCTCATGGCCTACATCTC
Associated Phenotype:
Not determined