Busch Lab

ZMP

fmnl2a

Ensembl ID:
ENSDARG00000012586
ZFIN ID:
ZDB-GENE-081105-70
Description:
Novel protein similar to H.sapiens FMNL2, formin-like 2 (FMNL2) [Source:UniProtKB/TrEMBL;Acc:B0V1Q0]
Human Orthologue:
FMNL2
Human Description:
formin-like 2 [Source:HGNC Symbol;Acc:18267]
Mouse Orthologue:
Fmnl2
Mouse Description:
formin-like 2 Gene [Source:MGI Symbol;Acc:MGI:1918659]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa7172 Nonsense Mutation detected in F1 DNA Not yet available
sa6108 Nonsense Mutation detected in F1 DNA Not yet available
sa21427 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa7172
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 15 1077 1 26
ENSDART00000133090 None None 476 None 11
ENSDART00000138015 None None 468 None 11
ENSDART00000147920 None None 353 None 8
Genomic Location (Zv9):
Chromosome 9 (position 4862643)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4890384
GRCz11 9 4856725
KASP Assay ID:
554-5343.1 (used for ordering genotyping assays)
KASP Sequence:
ACAGAGAGATGGGGAACGCGGGGAGTATGAACCAACACACTGACCCCAGA[G/T]GACACCACATGCCCCTCAAACTGCCCATGCCCGAGCCAGCGGAGCTGGAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa27333
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 68 1077 3 26
ENSDART00000133090 None None 476 None 11
ENSDART00000138015 None None 468 None 11
ENSDART00000147920 None None 353 None 8
Genomic Location (Zv9):
Chromosome 9 (position 4820142)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4847883
GRCz11 9 4814224
KASP Assay ID:
2260-1444.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACAATGCCTTCACGTTTTAGTGATGTCTTTATCTTTCTATTCCAGGAA[C/T]GATTTCAGGTGAAGAATCCACCTCACACATACATCCACAAGTTACAGAGT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6108
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 367 1077 12 26
ENSDART00000133090 None None 476 None 11
ENSDART00000138015 None None 468 None 11
ENSDART00000147920 Nonsense 169 353 6 8
Genomic Location (Zv9):
Chromosome 9 (position 4773845)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4801586
GRCz11 9 4767927
KASP Assay ID:
554-3818.1 (used for ordering genotyping assays)
KASP Sequence:
CRCTCTCSCTATAGAAGCTGAAGCACACYGAGAGCGATAAGCTGCATGTG[C/T]AGATTCAAGCATACCTGGATAACGTGTTTGATGTCGGAGCTCTGTTAGAG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa21427
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016814 Nonsense 715 1077 17 26
ENSDART00000133090 Nonsense 106 476 2 11
ENSDART00000138015 Nonsense 106 468 2 11
ENSDART00000147920 None None 353 None 8
Genomic Location (Zv9):
Chromosome 9 (position 4759425)
Other Location(s):
Assembly Chromosome Position
GRCz10 9 4787166
GRCz11 9 4753507
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACCTGGCCATCACCCTTAGGAAAGTGGGCAAGACATCAGAGGAGATCTGC[A/T]GAGGCATTCAATTGTAATTCACAGCTGACACACTATAGATATTTCACTGT
Associated Phenotype:
Not determined