Busch Lab

ZMP

ak5

Ensembl ID:
ENSDARG00000012555
ZFIN ID:
ZDB-GENE-030131-8256
Description:
adenylate kinase isoenzyme 5 [Source:RefSeq peptide;Acc:NP_001093554]
Human Orthologue:
AK5
Human Description:
adenylate kinase 5 [Source:HGNC Symbol;Acc:365]
Mouse Orthologue:
Ak5
Mouse Description:
adenylate kinase 5 Gene [Source:MGI Symbol;Acc:MGI:2677491]

Alleles

There are 5 alleles of this gene:

Allele Name Consequence Status Availability
sa32844 Nonsense Mutation detected in F1 DNA Not yet available
sa25759 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa18317 Essential Splice Site Available for shipment Available now
sa2067 Nonsense F2 line generated Not yet available
sa32843 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa32844
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 291 563 6 14
Genomic Location (Zv9):
Chromosome 2 (position 8780355)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9198009
GRCz11 2 8996014
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GACGCTTGACTAATTTCAAACAGAATGCCATCCCCCTGGTTAAATACTTC[C/T]AAGAAAAAGGCCTCATCGTCACAGTAAGGAATATGTTTGAATATTTATTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25759
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 299 563 7 14
Genomic Location (Zv9):
Chromosome 2 (position 8708027)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9125681
GRCz11 2 8923686
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATATATATTGTACTGATTGTCTGACATGAGTGATTTTTCTTTTATGCA[G/T]CTTGATGCAGATCGAGATGAAGAGGAAGTCTTCTATGACATCAGCATGAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18317
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Essential Splice Site 369 563 9 14
Genomic Location (Zv9):
Chromosome 2 (position 8654363)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9072017
GRCz11 2 8870022
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TGTCAGGCTGATGAAGAGGYGGCTGAATATGCAGAGGCGATTGGAGAAAG[T/C]GAGTGCAGTCTTTTNCAATGTATCTTCWTGCACTGTATTTGTGTGTGGGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa2067
Status:
F2 line generated
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 427 563 11 14
Genomic Location (Zv9):
Chromosome 2 (position 8647528)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9065182
GRCz11 2 8863187
KASP Assay ID:
554-3371.1 (used for ordering genotyping assays)
KASP Sequence:
ACATCCTGTGCAGTGAGCTGCAGTCTCACAGCGAGAGAGGACGCTTTCTC[C/T]GAGACCTTCTGGAAAGAGGAGAGCAGCTTCCCGAGGTGCACAATCTTGTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000022768 Nonsense 480 563 13 14
Genomic Location (Zv9):
Chromosome 2 (position 8640822)
Other Location(s):
Assembly Chromosome Position
GRCz10 2 9058476
GRCz11 2 8856481
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAGATCTGCTTGTGTGTGTGTGTATGTGTGTGTGTGTGTTTCAGATGGGC[C/T]AGCCAGACATAGTTCTGCTACTTGAATGTTCTGCAGACATCATGAGTCGA
Associated Phenotype:
Not determined