Busch Lab

ZMP

zgc:77849

Ensembl ID:
ENSDARG00000012458
ZFIN ID:
ZDB-GENE-030131-1107
Description:
UPF0472 protein C16orf72 homolog [Source:UniProtKB/Swiss-Prot;Acc:A2BE76]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa13623 Nonsense Available for shipment Available now
sa19421 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa13623
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025604 Nonsense 54 265 1 4
Genomic Location (Zv9):
Chromosome 1 (position 7770594)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8010399
GRCz11 1 8694510
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CGGCCGAGGAGGAGACCGATCAGAGCCAACAAAAACTCTGGCATCTTTTC[C/T]AAAACTCCGCCACCGCCGTCGCACAACTGTATAAAGGTGTGAAATGTGTA
Long Flanking Sequence:
GGCGGTGTCTTCATTCGTTGTCGCTCTATGACAGATGACTGACTGTTCACGCGACCAATAAACATTTAAGCTGTTTAGGCCAGTACACGCCCCCAAAAATATGTAGCCAAGGAGAATCGAGTATAACTCTAGAGGGAGAGGCTTGTGCCTCGGCAACGTTAAGTTGTTTTCATCGGCTGTGTGGCGGAGAAGTGCAAGCACCGTTCGCTATGCAGACGTAAACTAACAGCTGTCGATGAGGCCGCCGCCGACAAACCACTTCGGCCGGGTTTAAACGCCACGGAGAACTTTTCCAGCGAACGTTAGAGCATCACAGCAGCGGTTTACGTGTTTTTGTGGCCATGGAGGAGAAGAAGGAGGAGGGGGAAGCGGAGATCCAGGAACACGGACCCGAGCACTGGTTCTCCAAATGGGAGCGGCAGTGCCTAGCCGAGGCCGAGCAGGAGGAACCGGCCGAGGAGGAGACCGATCAGAGCCAACAAAAACTCTGGCATCTTTTC[C/T]AAAACTCCGCCACCGCCGTCGCACAACTGTATAAAGGTGTGAAATGTGTAATAAAAAGTCATCGCGAGCTAGCCAGCTAACTCTTGACACTGACAAACAAAGGACACTAACTCAAAAGCTCAGTGAATAGCCACCAAATTAAACCTAACACGAATAAATTAGGCTGGCGAGCGGTTGCTTAATAACAAAACACTCACGTTTGGGGTTCAAATACGGCTATGTCGTCTGTTATTTGCTTGTTTTGAAGGTCGGTGGTGTTTACAGATTAGCATTGATGCTAAGTGGCAGACGAGCGACGTAAACTGACACTCATCGTTTATATGAGGAAACAACCCAGAAATGTCTCCATTTATCAGTTTTAGCTGTTAATAGAGCTGACTACATAATGCGTAAACGTCTAACGTTATTGTGATATTTTAAAATATTTAAAGCGTCACCCAGCTGGTTGTCTATGAGCGAAACAAAATGGCGAAGTGCAGGGAGGAGTTCATCTGATGAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa19421
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025604 Nonsense 103 265 3 4
Genomic Location (Zv9):
Chromosome 1 (position 7774708)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8014513
GRCz11 1 8698624
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATTTTTTTTTTCTTCTTTTCAGAGAGTGTTGATGCCCATCAGCGGAGTTA[T/A]GAGCTGGGTATTCAGATAGGCCATCAGAGGAGAAATAAAGATGTCCTGGC
Long Flanking Sequence:
TTCCAGCCTGGCAGCGGAAACCCTGTCAATTGAAACAAATCTTCATGCCTGCCAGTTTTGGTTGAGGCGGTTTATTTGTTGCCTATTATGGAGAGAAAATAATATATTGAAGAACAGTGGCTGCCGGTCCTGAGGAGATAATGCTGCTGTTCTGGCAGAACAAAAATTTATGGTGTTACACAATTGCTTTGGAAGTTGATGATGTAAGATTTACATAATTACATTATTAAATCTTCCTATTTTAACCATCAGCAATAATTTACCTGCTGTTCATTTTCTTCCTTCGTGTAAAATGTTTGCTCTCTGCTTGATGCTGTTTTAAAATTCTAAGAGGGGCTTTTTGATTTCAGGAATTGTTAAATGAGACTGACATCATTGGGCATAAAACACTAGGAGACGTTGATGCAGCTGTGCTGATTCCTGACACGCATGCAAAAATGCTCATTTCCTATTTTTTTTTTCTTCTTTTCAGAGAGTGTTGATGCCCATCAGCGGAGTTA[T/A]GAGCTGGGTATTCAGATAGGCCATCAGAGGAGAAATAAAGATGTCCTGGCGTGGGTGAAGAAACGGAGGCGGACTATTCGGCGTGAGGATCTTATCAGCTTCCTCTGTGGTAAAGCCCCACCGCCACGTAGCTCCAGGGCTCCGCCAAGACTTGCAATGGTGTCACCAAGCCGACCCACGCCCTCGGAGACGAGTTCATCTGTAGAAACTGACCTGCAGCCTTTCAGGGAGGCCATTGCCCTGCACGGTGAGTGTGTTCGATGACATCCATTTCATTGAGACTTCACACAGAAACTATTTATTGCAGAATGTCACAATTTTGAAACTGTAATAATTAAGGAGTAATATCTAATCGCATTGTAATGTTAATCTGTATCTGTGAATATTAAATAGGATAAAGGCTATTGGATTATGACGTCTGTGTGAATGATTTGCGTGGTGTCATGCATTACAGTCAAACACACGACACTTGATGTTTTTAAATATATAAGCACATGAAT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3350
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025604 Nonsense 240 265 4 4
Genomic Location (Zv9):
Chromosome 1 (position 7777735)
Other Location(s):
Assembly Chromosome Position
GRCz10 1 8017540
GRCz11 1 8701651
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TAGACCTCAACACTTTCATTGCYGAGGAGATGGCGCTCCACCTCGACAAC[G/T]GAACTCGGAAACGAAGCTCCGCCCAGTGCAATGATGTCATAAYAGACTCT
Long Flanking Sequence:
TCAAGACTTTCAGTCTCGTTCACTTCCATTGATTTTTAGATGTTTAAAACAGCTCGTTCTGCTGCTTGTTGTTGCAAACTGATATTTTCTAATGAAATTATTCTACTTATTATGTAAAGTCATGCACACACTTGTTTGTAGAGCAAGTAGTTTGACCGTTTTCTGCCGTGTATTATACCTAGTCATTTCTCCCATAGATGACTGAATCAGAAGTTCTAAAACAATGGCAAAAATGAGCGTACTTCCGCATTGAATAGTAAGGTCAACAGTGGCCGCATGTTGCTTTGACAAAAGTAATAGTTAATATATTGAATATGTTTCTCTACCTCTGTGTTGAAGGTCTAAGTGGAGCCATGGCGAGTATCAGTATGCGCTCCGGAGCTCCAGGTTCACCTACACACCTGAGCGCCAGCTCCGCCCCCAGTCGCCGCAGAAACGGTCTCCACGACGTAGACCTCAACACTTTCATTGCCGAGGAGATGGCGCTCCACCTCGACAAC[G/T]GAACTCGGAAACGAAGCTCCGCCCAGTGCAATGATGTCATAACAGACTCTCCCACTCACAAACGCAATAGGATGATCTGAGCTCTTAAGTAAACAGAAACAACACCATGCGTGAGAAAAAAAATGCCACTCCTCAGTCATCCTCCCATCTTTATTCAGACCAGGAAATAAAAGCAGCCAATAACAGTGCTCACCACAGCCCAGCACATCTCTGATTGGTCTACAGAGCCCTGTTGAGGTCATCGGTGGGAGACGGTGTTCAGTGCAGAGGCCTAAGTGCCCTTCCATAGGATCCTGTCGACAAACACACAACCCTCATTCACTATATTGCTGTGTGAGTTGATTGTGTGTGTGTGTGTGTGTGAGTGTGTGTTATTATGGCTGAACTGAGACGTGATCGAACGCAGGAACAAGAAAACATTTTTGTGTGCATGTTCGCAACATAATGAGCAACGTCTGTATGATTGCGTGTGTATACAAGTACTTGGTGTGTATGTGTGT
Associated Phenotype:
Not determined