Busch Lab

ZMP

efemp2

Ensembl ID:
ENSDARG00000012437
ZFIN ID:
ZDB-GENE-041212-8
Description:
EGF-containing fibulin-like extracellular matrix protein 2 [Source:RefSeq peptide;Acc:NP_001008587]
Human Orthologue:
EFEMP2
Human Description:
EGF-containing fibulin-like extracellular matrix protein 2 [Source:HGNC Symbol;Acc:3219]
Mouse Orthologue:
Efemp2
Mouse Description:
epidermal growth factor-containing fibulin-like extracellular matrix protein 2 Gene [Source:MGI Symb

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa42407 Nonsense Mutation detected in F1 DNA Not yet available
sa1694 Essential Splice Site Available for shipment Available now
sa15681 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa42407
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Nonsense 23 440 2 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563474)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353531
GRCz11 14 30693845
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTGCTCTTTTGTATGTGCATCTCTGTGTTTCTCCACCGCGCTATTTCA[C/T]AGCCACCCACAGAAACTGACACCTACACGGTAAGGAGGAACGAAACCTTC
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28323
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Essential Splice Site 32 440 2 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563444)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353501
GRCz11 14 30693815
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTCTCCACCGCGCTATTTCACAGCCACCCACAGAAACTGACACCTACACG[G/A]TAAGGAGGAACGAAACCTTCCCCTGTCTCTCGCTACACTTTCTTTATCTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1694
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Essential Splice Site 32 440 2 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563443)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353500
GRCz11 14 30693814
KASP Assay ID:
554-1640.1 (used for ordering genotyping assays)
KASP Sequence:
TCTCCACCGCGCTATTTCACAGCCACCCACAGAAACTGACACCTACACGG[T/A]AAGGAGGAACGAAACCTTCCCCTGYYTCTCGCTACACTTTCTTTATCTTC
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461

Mutation Details

Allele Name:
sa15681
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000028849 Essential Splice Site 33 440 None 11

The following genes are also affected by this mutation:

Genomic Location (Zv9):
Chromosome 14 (position 31563297)
Other Location(s):
Assembly Chromosome Position
GRCz10 14 30353354
GRCz11 14 30693668
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GGTGTAMTCAGGCTACATCTACAGWGTTTACTTATTCATGTGTATTTTAT[A/T]GGAATGTACAGATGGATATCACTGGGATTCACAGACTCAGCACTGCAAAG
Associated Phenotype:
Not determined