Busch Lab

ZMP

rnf207

Ensembl ID:
ENSDARG00000012409
ZFIN ID:
ZDB-GENE-080227-9
Human Orthologue:
RNF207
Human Description:
ring finger protein 207 [Source:HGNC Symbol;Acc:32947]
Mouse Orthologue:
Rnf207
Mouse Description:
ring finger protein 207 Gene [Source:MGI Symbol;Acc:MGI:2684989]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa43968 Nonsense Mutation detected in F1 DNA Not yet available
sa17871 Nonsense Available for shipment Available now
sa9730 Essential Splice Site Available for shipment Available now

Mutation Details

Allele Name:
sa43968
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077945 Nonsense 33 634 1 17
ENSDART00000142000 Nonsense 33 634 2 18

The following transcripts of ENSDARG00000012409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21808894)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21588201
GRCz11 23 21514752
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGTGCCAACTGCCATCCTCTAGTGTGCCACTTGTGCCAAGAGCAATAC[G/T]AGCATCCATGTTTACTGGACTGTTATCACACGTTCTGTGCCAGTTGCCTG
Long Flanking Sequence:
GCATTGTGACCTCAACAAATCACCCTTGTCATACCACACATACAGGAGAGTTCATTGTTTGTTTTTTGTCACATCCTGCATCGGAAGCCACTTCAACCAGCAGAAGCTCTTGGACAGGACAAGGTATTTAGATATCCATTATATGAGAACGAAATTACATATATACATTAAATAGTTTTTTTACTTTTCAGTACTAAATTAATATAAAAGTCAGCATAGGACCTTTATATTGCTCCAAAGTCTATTTAGAGTCTAATAATGAACATTAACCTCGGTGTCTAAAGAACATTTGAATAACGGAGAGCTCCAGGATACCATCTATGCTCATAATCATACATCTGATAGATAAATGCGCTCAAGGATACACTATATCAAGTTTCCGAAGGTCTTCCCTGTATTTTCAGATGTCCGGAGAGATCTTTTACTCTGTGGATAATCTCTATGACCTGGACAGTGCCAACTGCCATCCTCTAGTGTGCCACTTGTGCCAAGAGCAATAC[G/T]AGCATCCATGTTTACTGGACTGTTATCACACGTTCTGTGCCAGTTGCCTGCGTGGAAGAGTCGCGGACAGCCGTCTGACTTGCCCTGTATGTGGGTAAGAATATAATATATGCTATCATTGATCAACTTATTTTGACAGTTCAACCTGTATTTAAATCACTTGCAGCGGTTTAAAGGCTCACATGAAGCCATGCATTTGAGACTGTATTTATAGATGGTCAAATAACAATGTCTGGGCAACTCTACAGTGCCAAACAGCTGCACCATAAACCCGGCCTCTGTGCTGGACTTAATCAAAGGTCTCTGGGCGCATTCTAGCATGGCCACCATGGCATCAAACAATAAGCCGAGCACTATCTGATACTTGACATTGGATCCGCAGGTCGTGGGCTGGCTGCAGACAGAGATGGCTGAAATGCCTGTGCATGCACTCGTTGTTCTGTCGCCATATACTGTAGTAAGTCTAGCAGCAGCTTAAACGCACACCGTAGATCTCGCAC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa17871
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077945 Nonsense 280 634 8 17
ENSDART00000142000 Nonsense 280 634 9 18

The following transcripts of ENSDARG00000012409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21801061)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21580368
GRCz11 23 21506919
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ACTATTTTTTAGTCAGCATGAAGAGAAGGAGAGAACCTTTAAAGAGCAAT[T/A]ATCTCAWCTTGCTGCACTCCTGCCAACTCTCCAGGTAARTACATTTCCTC
Long Flanking Sequence:
AAGGTATTATCACATATAAGTAGGGGGGATTTATGCAGAATGATTTTGGGGGTATCATAACTAAAAACTTAATATATGAAATAAATTGTATTTAATGTTTACAATGCACATCCAATAAGGTCCACTTATTTGCAGAAATATCTGCATAAATCTGCAGATTTCTGCGTGCTCATATTCCATGTGGGCCTACATAAAAGGTACTGAAAGTACATGTATCTACAGTATATAAAAACATTTCTAAAATGATTTACAAAAATTAAATATATTTTTAAACGTTTGCATAGAGTACATAGTATATTAATATAAAGTGGGTCTGATAATGTAATTTTAACATTTTAATATCTGTCTTTTATTACCTGTCAACCATAATTGTCAGGATTGGACAATTGTCAGAATTATGCTCCAAAAATGTAATAATACAAATATAGCTATTTATTTATACATTTCATAACTATTTTTTAGTCAGCATGAAGAGAAGGAGAGAACCTTTAAAGAGCAAT[T/A]ATCTCATCTTGCTGCACTCCTGCCAACTCTCCAGGTAAATACATTTCCTCCATGTCTCCATAAATATTAGCTTTTCATTTATTCTCGCTTGCTTCCAGACACATTTTTTTTGTTTGTTTGTTTTTTTCTACAGGTTCATCTTGTTACATGCTCTGCCTTCCTAAGCTCAGCAAATAAGTTTGAGTTCTTAGACATGGGATATGTGAGTACAAACTGCAATCCGAATCTATTGCATCGATAGACTCATTAGTTATGCCAAATATGTGAATTAGACTTATATGCACAAACCTGGAATATTGCATAAAACATTTGCGAATAGTTCTCAGTTTTTATCAAAGTCGAAATCGTCACTTTCTGATACACTGGCTAAAGAAAACTTTGGTACCATTGCAGAAAAGCCATAAGTCACTTTCCAAAACCTTTTTATTCAATGTTCGCCACTGTTGGAATAATCTTCCCATTTCAACACAGATTGCAGATTCACTGGAATCCATCAAACA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9730
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077945 Essential Splice Site 556 634 15 17
ENSDART00000142000 Essential Splice Site 556 634 16 18

The following transcripts of ENSDARG00000012409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21795064)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21574371
GRCz11 23 21500922
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GKTCCCTACATCCGCTCWATAGCAAAAGTGAAGGAACGTCTGGAGCCAAG[G/A]TACTAGAGAGCTTGATTTATAAGTTTCATGGCTTATAAAGTTTCATGGAT
Long Flanking Sequence:
ATCCAGAAGCTGAAAGACCAGGTGCAGGAGATTCACAGAGACCTGACCAAGCACCACTCCCTCACCAAACCTGACAGCATGAGTGAGATTTTGGAGAAGTCAGTACAGGTGGACAGTCAGATCTCCTCCGAGTATGCTTCAGTGGAGCTCATGCGGGCCATGTTCGAGGAGGTGAGATCCCAGTGCTTTCAATCAACATTAGAAAGAGGTACAATCGGATTCGAAATGTCATCATTTTTGTTCCTAGATCTGGGAGGAGACTTTACAGAGAGTGGCAAATGAACAGGAGATTTATGAAGGTAAACACTATTTTACTCGGTAAGCGCTTCACTCTAGTTGTGTTGTTATATCAAAGTTAACAGTTCAATGATTCTTTTTTTAGCGCAACTTCATGATCTGCTTCAGTTAAAACAGGAGAATTCCTATTTGACAACAATCTCCCGACAAATAGGTCCCTACATCCGCTCTATAGCAAAAGTGAAGGAACGTCTGGAGCCAAG[G/A]TACTAGAGAGCTTGATTTATAAGTTTCATGGCTTATAAAGTTTCATGGATTTATACGTTTTACATTAGAGCAATATAAATCAAGTGAGCCTTTAAAAGTGAAGCTAAACATTATTGCCACCCGGTGGCAGGCTTGAGTATTGTTATGAATTCAACTTGTCATTTTTCGTTCCTATCACGCTGTTGTTTAAGTGTTTTTTTTAAAGAGGTTAATTATTTTATGCATATTTGCAGTTGCGCTTGCAGGATTTTAGGTTCCAGTTGCCACCATCTGTTTCATAATCCAGGGACTTTGGCTTCACATTTCTAGTGTATTGAATGTTTTTTGTGTGTGTGCAAATTTTATCTTCAACAGGCTGAAGGAGCCTAAAGAACTCAAGGATGATCGCACAGAGATCATGTTGAAGCTCTATGAGGACAGCACGTCTACAGCTGACACACAGCCAAGGTGAGTCCACATCAGTATGTTAAAAGCATATCACGCTCTTATGTAGACACATT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29913
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000077945 Nonsense 592 634 17 17
ENSDART00000142000 Nonsense 592 634 18 18

The following transcripts of ENSDARG00000012409 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 23 (position 21794489)
Other Location(s):
Assembly Chromosome Position
GRCz10 23 21573796
GRCz11 23 21500347
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GATAATAAAAGCTATTCCATGTGTCATAATTACAGTAATGAGCTATCCTG[C/A]AACACTGAAGACAACTGGACTCTAAACAGCCTATCAGAAGAGACCAATCC
Long Flanking Sequence:
ATAAATCAAGTGAGCCTTTAAAAGTGAAGCTAAACATTATTGCCACCCGGTGGCAGGCTTGAGTATTGTTATGAATTCAACTTGTCATTTTTCGTTCCTATCACGCTGTTGTTTAAGTGTTTTTTTTAAAGAGGTTAATTATTTTATGCATATTTGCAGTTGCGCTTGCAGGATTTTAGGTTCCAGTTGCCACCATCTGTTTCATAATCCAGGGACTTTGGCTTCACATTTCTAGTGTATTGAATGTTTTTTGTGTGTGTGCAAATTTTATCTTCAACAGGCTGAAGGAGCCTAAAGAACTCAAGGATGATCGCACAGAGATCATGTTGAAGCTCTATGAGGACAGCACGTCTACAGCTGACACACAGCCAAGGTGAGTCCACATCAGTATGTTAAAAGCATATCACGCTCTTATGTAGACACATTAGAGGGAAAAGCTGTTAATTATTAGATAATAAAAGCTATTCCATGTGTCATAATTACAGTAATGAGCTATCCTG[C/A]AACACTGAAGACAACTGGACTCTAAACAGCCTATCAGAAGAGACCAATCCTAAAAACAAGGATTACTACAGGACAAACAAGCAAAAGAACACCACAGATTCAACCAATCGCAAAGAGATTCCAATGTGATATGTCAGCTTTGACAATTGTAACCACAAAAAAAAATCTAATACACCAGTTTGAAAGACCTACACTGCCGAGGCCAAAAAAAAACTTCCACGACTGAGTTTAGCATGATTCACAGTGGCTCAGCTCTGAGATCTGTAGATTTAATTTTACAGTATGTGTTTTGTCAAACTATGTTAGACAGCCTAATGTTATGTAATGTCACTAAGTGTATTTCTATCAAAATTAGCATTTATTTTGCCAAAGATATTGTAGACCTTGTTCTAATAAACCGGAAGCATGTCTACTGTCTGATATCAGTGGTGTGAAGTAACAAATTATAAATAGTCAAACTACTGTAATTGAGAAGATTTTTCTTAAGAATTGTAAATTAC
Associated Phenotype:
Not determined