Busch Lab

ZMP

col1a1a

Ensembl ID:
ENSDARG00000012405
ZFIN ID:
ZDB-GENE-030131-9102
Description:
collagen alpha-1(I) chain [Source:RefSeq peptide;Acc:NP_954684]
Human Orthologue:
COL1A1
Human Description:
collagen, type I, alpha 1 [Source:HGNC Symbol;Acc:2197]
Mouse Orthologue:
Col1a1
Mouse Description:
collagen, type I, alpha 1 Gene [Source:MGI Symbol;Acc:MGI:88467]

Alleles

There are 4 alleles of this gene:

Allele Name Consequence Status Availability
sa25246 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa1748 Nonsense Available for shipment Available now

Mutation Details

This allele has been removed from public view.

Allele Name:
sa3437
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Essential Splice Site 198 1447 8 51
ENSDART00000047010 Essential Splice Site 198 1366 8 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 23516428)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23094639
GRCz11 3 23225187
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
CCAAGGATTTACTGGTCCCCCTGGCGAGCCTGGTGAGGCTGGTGCTCCTG[T/C]GAGTATCTAAATTAGTTATCTGCAAACTCATCAACCCTGCTTCATTCTGT
Long Flanking Sequence:
GCAAGGTTCACCTATTTATCTTAATATAAAATCACCATAGAGTGAAGTTTTAGCACACACAGTCAAATCAGCTGTTAAAATGTTGACTCTGTTTTTTTTTTTTAAAAGGGACCTATGGGCCCCCGTGGAGCCCCTGGACCTCCTGGACCTTCCGTAAGTACAGTTCTTGAAAACATTTTTAAAATGTAAAGTGCTCCATAGTGTAATTCATAATTAAATTAATTTGGGGTATTAAGTATTATTTTGGAGACTGAAATTTGCCTTATGCATCTTTCAAAAATGAATATATCATATACAAATTGAAATCAACATATTTTGGGGACATCTGAATGATCTCTTCATATTAAGATTCACTCAGGAAATCTAACACAGCTACTTCCATTGTTTAGCATGTACTAGCACTGTGATTCCTGCTTTAATTTGTGCACTTTGTCCACCTTTACAGGGACCCCAAGGATTTACTGGTCCCCCTGGCGAGCCTGGTGAGGCTGGTGCTCCTG[T/C]GAGTATCTAAATTAGTTATCTGCAAACTCATCAACCCTGCTTCATTCTGTTCATTACATAAACAGTTAGAAAATTCCTTAAACAATGAACTGACCATGAAATCTGAGATTGCTCTACCTGTTTACATTCACCTATATTGATAGAACCTTTACCTACTTGCATATGTGCCCGAGTTTGAGTCATTTGGGTCAAATGAGGTCAAAGGTAAACAAAGTTCATGTAACTTGACCTTAGCCATCTAGACTGCTTTTCTACTGTATGGATGCATGGACATGCAGTCTGTGTCTCAACAGAGCTTTCTTTCTGACCTGGCAAGATTTTCACTTTATTTCATCTGGATAATTCAGAACTGCCAAAGTGTGACTCACTCATGCCGCCACACAGTGACACACATAAATACACTCACATGGACACTGATGTTTTTTCCTAACCTAGACTTTCTTTCATTCTGTAGGGTCCAATGGGTCCCCGTGGCGCTGCTGGTCCCCCTGGAAAGAATG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa26052
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Essential Splice Site 336 1447 16 51
ENSDART00000047010 Essential Splice Site 336 1366 16 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 23518210)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23096421
GRCz11 3 23226969
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CAACTGGCCCTGCTGGTCCCCCAGGATTCCCTGGCGGCCCTGGATCTAAG[G/T]TAAAAACATATATATTTATATTTGTTCATGATTAAACATATTCAAACTCA
Long Flanking Sequence:
TCTGTTTTTCAGGGTCCCCGTGGTCTGCCTGGCGAGAGAGGCCGTGCTGGTCCTCCTGGTGCTGCTGTAAGTAACCTTTCAACCCTGATCTAATCTGTACTTTGTGTCCTAGTATATGTTTACTTGCAGGTTCTCACCTTCCTAAATAATATATGCATGGAAATTAAACCCTTCACAATAGCTTAACAGCCATTTGGATATGATTTTTATAAGTACATATATGTATTAATATAGACATTTTGTTTAAAATATATAGTGTGCATATTATGTTTTGTAATGCCTACAAATAATCACACTCAAACTAAATCTTTCAGGGTGCTCGTGGTAATGATGGTGCCGCTGGAGCTGCTGGTCCTCCTGTAAGTAGCTACAATATATAAAAATAATAATAATAGCCTGAAAAATTATGATGACTAAAATATATTTCTTTAATTCTTTTGCTTTAGGGCCCAACTGGCCCTGCTGGTCCCCCAGGATTCCCTGGCGGCCCTGGATCTAAG[G/T]TAAAAACATATATATTTATATTTGTTCATGATTAAACATATTCAAACTCAAAATCAAACCAAACAAACTCTAGAGGACACAAAATGTCACTGTAGTTGGATCAAAGGCACCAGATGTCTGGATTGTTGGCAATTTTGTTAATCATCATGATGATGTAGGCCAACAATGAATGAATGAATCCTTGGCAAATATTTGTAGGTCAAATCTTAGAGTAACATATTTATTAGCTTATTACTTGTTTGGTTTTATTGGTTAATATATAATTAACTTCAACCATTTACAACAGAAATTCAGGTGTTCAGAAATCCTGACACAAATACCATGAGAATCTTTATTTTTATGCAATTCTAAATTTACAATAACTGTTGAGATGCCCCTTGAAGCATTTCTTAGGTGTTTTATTAGGTGTTTTTATTGACCTATCTGTTGCATTTGCTTTCTTTAGGGAGAGGTTGGTCCTCAGGGATCCCGTGGTGCAGAGGGACCTCAGGGAGCCCGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa25246
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Essential Splice Site 693 1447 31 51
ENSDART00000047010 Essential Splice Site 693 1366 31 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 23522794)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23101005
GRCz11 3 23231553
KASP Assay ID:
554-7696.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CTGTTGGTGCCCGTGGTTCTCCTGGTTCAGCTGGTAACGATGGTGCCAAG[G/A]TAAGTCTCATCTCTTCTGACTATTTTTATCATGCCAGACATTTACAGTGA
Long Flanking Sequence:
TCTAAATGCTGTATTTTTGTCATTGATGTTGATTTTAGATTGTTCATATCTTTGTTGTGCATCTGAATGACAGGGTCTGCCAGGACCTCAGGGTGCTACTGGTGAGCCAGGAAAGTCTGGTGAGCAGGTAAGTTTAAATGTAATTGCTGTCTATTGTATGATCAATGAAGCATTGCTTAAAAGGACACTACACATAAACATGGGCAACTTTGAAAGCCTTATCAATACTAACACAATACTAATTTGTGCTCTTTGATATAATACAGGGTGCTCCTGGAGAAGCTGGAGCTCCTGGACCTTCTGGTTCTAGAGTAAGTATCTACCAGATGATCAGCAAATGGCGAAAAGCTCATATATGAGAGGGACCAGAACTAATGGCATCTGTATTCATTTTTACTCAGGGTGACAGAGGATTCCCTGGTGAGCGTGGTGCCCCTGGCCCTGCTGGCCCTGTTGGTGCCCGTGGTTCTCCTGGTTCAGCTGGTAACGATGGTGCCAAG[G/A]TAAGTCTCATCTCTTCTGACTATTTTTATCATGCCAGACATTTACAGTGAATGACTAAGATAAATCAAAGGTTGCCACCAAATGTGAACCAATCTCCTGGAAAGTATGGCAACAAATCCTAGTCTGTATCAACATTAAGATAACTTGTTTTTCAGGGTGAAAGTGGTGCCGCAGGTGCTCCTGGTGCCCAGGGTCCTCCTGGACTTCAAGGAATGCCTGGAGAGCGTGGGGCTGCTGGCCTCCCTGGTCTTAAGGGTGACAGAGTGAGTATGACACAAACTGAACTTTGAACAGTTTGTCTTTGACAGAAAATATTGTTCCAACATACAGCGAACAAAGTTGTCAAAATTGTTGATCTCTTATCCCAGGGTGACCAAGGTGCCAAGGGTGCTGATGGTGCTGCTGGTAAAGATGGCATTCGTGGTATGACCGGACCAATTGGACCCCCCGGACCTGCTGGAGCTCCTGGTGACAAGGTGAGTGTCTTTTGAGCTAGATTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa1748
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000009393 Nonsense 1179 1447 48 51
ENSDART00000047010 Nonsense 1179 1366 48 52

The following transcripts of ENSDARG00000012405 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 3 (position 23526433)
Other Location(s):
Assembly Chromosome Position
GRCz10 3 23104644
GRCz11 3 23235192
KASP Assay ID:
554-1741.1 (used for ordering genotyping assays)
KASP Sequence:
GACCTCCTGGACCTCCCGGCCCCCCTGGAGCACCTGGACCCTCTGGTGGT[G/T]GATTCGAYATTGGCTTCATTGCCCAGCCACAGGAGAAGGCCCCTGATCCC
Long Flanking Sequence:
ATTCTGTTTGGAATATGGAATTTGCAGTATATGCCTTGATAATAAAATCTGTAGATTGAAATCTGTTTTCATTTCCAATATTCCTGTCCATAGGGACCCTCTGGAGAGTCTGGACCCGCTGGTGCTTCTGGACCCGCTGGACCAAGAGTAAGTGTTATTATAAAACTTGCACTACTGCTGTTTCTCTGTTTTGATCGAATACACCATGTCCTTAGTTCATTCTGATTAAATTTGAATGTTTCTCTTATTGTGTTAATAGGGCCCAGCTGGATCTGCTGGATCAGCTGGTAAGGATGGTATGAGTGGCCTCCCTGGACCCATTGGACCTCCTGGACCCCGTGGTCGCAATGGAGAAATTGGACCAGCTGTGGGTGATTCTTTCCTTTTTTACATAATCGTGCACTCAATAAACTAAATATATGCATTAACACAAGCGTATATGGTTATAGGGACCTCCTGGACCTCCCGGCCCCCCTGGAGCACCTGGACCCTCTGGTGGT[G/T]GATTCGACATTGGCTTCATTGCCCAGCCACAGGAGAAGGCCCCTGATCCCTTCCGTCACTTCCGTGCCGACGATGCCAATGTGATGCGCGACCGTGATCTTGAGGTTGACACCACCCTTAAGTCCCTGAGCCAGCAGATTGAGAGCATCATCAGCCCAGACGGCACCAAGAAGAACCCTGCCCGCACTTGCCGTGACCTGAAGATGTGCCACCCAGACTGGAAGAGCGGTATGTTACTTTTCTTTGTTGTACAACAATAGAGAAATGTCTCATTTAAAAATTTGTAAATGTATTGCCTTGCATAGTTTAATCCCATTCCTCTCAAAACCATAACACAGGCGAGTACTGGATTGACCCTGACCAGGGCTGCAACCAGGATGCCATCAAGGTCTACTGCAACATGGAAACTGGCGAGACTTGCGTCAACCCAACTGAGTCTGCTATTCCCAAGAAGAACTGGTACACAAGCAAGAACATTAAGGAGAAGAAACACGTCTGGT
Associated Phenotype:
Normal
Stage Entity Quality Tag
Larval:Day 5
ZFS:0000037
whole organism
ZFA:0001094
quality
PATO:0000001
normal
PATO:0000461