Busch Lab

ZMP

adssl

Ensembl ID:
ENSDARG00000012399
ZFIN ID:
ZDB-GENE-020419-28
Description:
adenylosuccinate synthase, like [Source:RefSeq peptide;Acc:NP_775344]
Human Orthologues:
ADSS, ADSSL1
Human Descriptions:
adenylosuccinate synthase [Source:HGNC Symbol;Acc:292]
adenylosuccinate synthase like 1 [Source:HGNC Symbol;Acc:20093]
Mouse Orthologues:
Adss, Adssl1
Mouse Descriptions:
adenylosuccinate synthetase like 1 Gene [Source:MGI Symbol;Acc:MGI:87947]
adenylosuccinate synthetase, non muscle Gene [Source:MGI Symbol;Acc:MGI:87948]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa6675 Essential Splice Site Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa4952
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016819 Nonsense 132 462 4 13
ENSDART00000134617 Nonsense 138 468 4 13

The following transcripts of ENSDARG00000012399 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25918399)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26488217
GRCz11 21 26524912
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTCTGTGTTCTTTTGCTTTGTATAATGCAGGACTTCAAGGATGGGAGGAA[C/T]GACTGAAGATATCTGACCGGGCACACATTGGTACTTTTCTGTTTTGACTT
Long Flanking Sequence:
GTGTCAACATTTAAAAAAAAAACTAATCTCTAAATTAGTAAGGTTCTGGCTGCACTGTGATCTGTAAATAATCTTTTATCACATTATTCTTGCTCTAAGTATTCCTGGCAAGTTTTATTTATTTATTTTTTTTCCATTTTCCCATTGAAATACGCTTTGAGGATGTTCGATTCAATTCACCTTTATTTCTATAGCGCTTTTACAGTGTAAATTGTGTCAAAGCAGCTTGACATAGACGTTCTAGTAAATTGAAACTGTCAGGCAAGTTTTCAGAGTTGAAGTTCAGTTCAGTGTAGTTTAATTTTCACTGCTGAAAGTCCAAACACTTAAGCGCAAATCCATCTATATGCAGCTTCAGAAGTCCCAGTGTCCCACAAGTCCCATGTGTTCTGTTAATCAAGATAGTGTTTTAATAATGAACTGAAAGCTGTGTTTCTGCTTTTGTATCAATTCTGTGTTCTTTTGCTTTGTATAATGCAGGACTTCAAGGATGGGAGGAA[C/T]GACTGAAGATATCTGACCGGGCACACATTGGTACTTTTCTGTTTTGACTTCATCTGACCTTCATCTGAGTGATTGAGATGTGCTGCAGATGGCATTGACTTTGTACAACGGTTGTCTCATTCAAATACAAACACTTTGATATCTGTTCTGTTGAAGTTAAAGCTCTTCTGATTTTTCATATAGTGTTCAACTTCCACCAGGCTGTTGATGGCATACAGGAGCAGCTCAGACAACAGCAGGCAGGAAAAAAGTGAGTTATTTTCATTTTGCATGGAAACAGTTGCTTTGTAGATAAGTTTTTTTGTTGTTGCTTAATTTTTTTTACTTGATTAATATTGAGTTTACGCTTTGTTTTACAGTTTGGGCACAACTAAGAAGGGTATTGGACCTGCATACTCCTCCAAAGCAGCACGTAATGGACTGAGAGTGTGTGATCTGGTCTCCGACTTCTCTGTCTTTGAAGAAAAGTGAGTATGAGAGATTTCCAATTGATTCTTTAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa29604
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016819 Nonsense 354 462 10 13
ENSDART00000134617 Nonsense 360 468 10 13

The following transcripts of ENSDARG00000012399 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25921567)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26491385
GRCz11 21 26528080
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ACAGGCAGGCGGCGGCGCTGTGGGTGGCTGGATCTGGTTTTGGTTCGCTA[T/A]GCCCACATGGTTAACGGGTTTTCAGCGTAAGTTGTGTTGAGTGTTTTACA
Long Flanking Sequence:
ATGTGGCCAACGCAAGCTGACAACAAATTTAGTTATGTTGGCGCTAGTTCATTGGCATTGGCACAGCCCTAAATGAACAGCACATTTTACTTTTGTGGGCGAAGCATCTCTTTAACTTTAGATGTATCCATGTCTCTCAGGGACCTACCCCTTTGTGACCTCATCAAACTGCACTGTTGGAGGCGTCTGCACAGGTCTTGGCGTCCCCCCATCTCATGTTGGCCGTGTATATGGAGTGGTGAAGGCCTACACCACCAGGGTTGGAGTCGGGGCATTTCCCACTGAGCAGAACAATGTGAGTGTTTTTGTGGGTTGGAAATAGTTAATCATTTTTTAATATTCAGTGACATTCTCTTGTTTGTCTTTATGTTTGAACATTTTTAATACTCTTTCATTTTGTAGGAAATTGGAGATCTGCTGCAGAGCAGAGGGAGGGAATTTGGAGTTACAACAGGCAGGCGGCGGCGCTGTGGGTGGCTGGATCTGGTTTTGGTTCGCTA[T/A]GCCCACATGGTTAACGGGTTTTCAGCGTAAGTTGTGTTGAGTGTTTTACATGTGCTTTCATTCAAACATTTGGCCAAATACTTGTTTTTTTTTTTTTTAACAATGTGTTTATTGTTTTTGATTTTGCAAGACAGGTAACAGAAAAACACTATTCCATTTCGTCACAATTATTTCACACCCCAACAAAAGAACAACACTCTCTTCTCCCCTATAGAAATACACAGAATTCTCACACAAGAGACAATTTGCAAAACAAAAATTGCTAGGTACCCAAAAACCAAGTATACATTACTGTATTTTACACACAAGTTACATTATCCAACAAAACGAAGCACACACACACACACACACACTCACAAATAAATAAAAAAAACTCTATACTTCGTTACACCTCTTGTAATAAATGACCAATATTATTGTTTTTAATTTAGTAATTAAACGGCTTCCATATTTCTTCATATTCATCTATTTTGTTTTTAGTAAAATATGTTACATATTTT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6675
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > C
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000016819 Essential Splice Site 363 462 10 13
ENSDART00000134617 Essential Splice Site 369 468 10 13

The following transcripts of ENSDARG00000012399 do not overlap with this mutation:

Genomic Location (Zv9):
Chromosome 21 (position 25921595)
Other Location(s):
Assembly Chromosome Position
GRCz10 21 26491413
GRCz11 21 26528108
KASP Assay ID:
554-5059.1 (used for ordering genotyping assays)
KASP Sequence:
TGGATCTGGTTTTGGTTCGCTATGCCCACATGGTWAACGGGTTTTCAGCG[T/C]AAGTTGTGTTGAGTGTTTTACATGTGCTTTCATTCAAACATTTGGCYAAA
Long Flanking Sequence:
TTAGTTATGTTGGCGCTAGTTCATTGGCATTGGCACAGCCCTAAATGAACAGCACATTTTACTTTTGTGGGCGAAGCATCTCTTTAACTTTAGATGTATCCATGTCTCTCAGGGACCTACCCCTTTGTGACCTCATCAAACTGCACTGTTGGAGGCGTCTGCACAGGTCTTGGCGTCCCCCCATCTCATGTTGGCCGTGTATATGGAGTGGTGAAGGCCTACACCACCAGGGTTGGAGTCGGGGCATTTCCCACTGAGCAGAACAATGTGAGTGTTTTTGTGGGTTGGAAATAGTTAATCATTTTTTAATATTCAGTGACATTCTCTTGTTTGTCTTTATGTTTGAACATTTTTAATACTCTTTCATTTTGTAGGAAATTGGAGATCTGCTGCAGAGCAGAGGGAGGGAATTTGGAGTTACAACAGGCAGGCGGCGGCGCTGTGGGTGGCTGGATCTGGTTTTGGTTCGCTATGCCCACATGGTTAACGGGTTTTCAGCG[T/C]AAGTTGTGTTGAGTGTTTTACATGTGCTTTCATTCAAACATTTGGCCAAATACTTGTTTTTTTTTTTTTTAACAATGTGTTTATTGTTTTTGATTTTGCAAGACAGGTAACAGAAAAACACTATTCCATTTCGTCACAATTATTTCACACCCCAACAAAAGAACAACACTCTCTTCTCCCCTATAGAAATACACAGAATTCTCACACAAGAGACAATTTGCAAAACAAAAATTGCTAGGTACCCAAAAACCAAGTATACATTACTGTATTTTACACACAAGTTACATTATCCAACAAAACGAAGCACACACACACACACACACACTCACAAATAAATAAAAAAAACTCTATACTTCGTTACACCTCTTGTAATAAATGACCAATATTATTGTTTTTAATTTAGTAATTAAACGGCTTCCATATTTCTTCATATTCATCTATTTTGTTTTTAGTAAAATATGTTACATATTTTACATACATACACTGTGCCATGGCATTAA
Associated Phenotype:
Not determined