Busch Lab

ZMP

adar

Ensembl ID:
ENSDARG00000012389
ZFIN ID:
ZDB-GENE-000616-5
Description:
double-stranded RNA-specific adenosine deaminase [Source:RefSeq peptide;Acc:NP_571671]
Human Orthologue:
ADAR
Human Description:
adenosine deaminase, RNA-specific [Source:HGNC Symbol;Acc:225]
Mouse Orthologue:
Adar
Mouse Description:
adenosine deaminase, RNA-specific Gene [Source:MGI Symbol;Acc:MGI:1889575]

Alleles

There are 6 alleles of this gene:

Allele Name Consequence Status Availability
sa16847 Nonsense Available for shipment Available now
sa18476 Nonsense Available for shipment Available now
sa22832 Nonsense Available for shipment Available now
sa6428 Nonsense Mutation detected in F1 DNA Not yet available
sa817 Nonsense Available for shipment Available now

Mutation Details

Allele Name:
sa16847
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 114 1373 1 15
ENSDART00000103213 Nonsense 114 916 2 16
ENSDART00000130112 Nonsense 114 1380 2 17
ENSDART00000146708 Nonsense 114 1381 2 15
Genomic Location (Zv9):
Chromosome 16 (position 25775541)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23621216
GRCz11 16 23536248
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGTAAGCTTCCGACAAAACCAGGTGCAGTTCCTCAGGGGGCAGAGTGCA[C/T]AAGCTCCTCAGTTCAAAGCACCCCAGYCGCGAGGGTCCCAAAGCTCTAGC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa18476
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
A > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 164 1373 1 15
ENSDART00000103213 Nonsense 164 916 2 16
ENSDART00000130112 Nonsense 164 1380 2 17
ENSDART00000146708 Nonsense 164 1381 2 15
Genomic Location (Zv9):
Chromosome 16 (position 25775691)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23621366
GRCz11 16 23536398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
GTGACTTTAAATCAAACAGTTACAGTTTTGGAAGAAGAAACTGTTACGGC[A/T]GAGGACAGGATAACTGGCAAGGGGAGCAGAATTTTGGACCTAAAAAAAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22832
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 193 1373 1 15
ENSDART00000103213 Nonsense 193 916 2 16
ENSDART00000130112 Nonsense 193 1380 2 17
ENSDART00000146708 Nonsense 193 1381 2 15
Genomic Location (Zv9):
Chromosome 16 (position 25775780)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23621455
GRCz11 16 23536487
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
CCTAAAAAAAGGTCAGGGTGGAATCACCCACACCAGAAGGGACAATATTA[T/G]TCAAATCAGCACTATAAACAATTCTGGAACGCTCGGGCAAATGATTTATC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa6428
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > G
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 545 1373 1 15
ENSDART00000103213 Nonsense 545 916 2 16
ENSDART00000130112 Nonsense 545 1380 2 17
ENSDART00000146708 Nonsense 545 1381 2 15
Genomic Location (Zv9):
Chromosome 16 (position 25776835)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23622510
GRCz11 16 23537542
KASP Assay ID:
554-5388.1 (used for ordering genotyping assays)
KASP Sequence:
GTTAGACAATGACAATGTTTTTGGTAACACAGAAATTGACATTCCTGGCT[T/G]AGAACCGGTATCCAAAGCAAGTGACCTTTCCTCCTCAACCCATCGGAACT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa817
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
G > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Nonsense 992 1373 8 15
ENSDART00000103213 None None 916 9 16
ENSDART00000130112 Nonsense 999 1380 10 17
ENSDART00000146708 Nonsense 1000 1381 8 15
Genomic Location (Zv9):
Chromosome 16 (position 25787935)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23633610
GRCz11 16 23548642
KASP Assay ID:
554-0721.1 (used for ordering genotyping assays)
KASP Sequence:
GTAGAAAAATTCTTGCAACTATTGTGATGCGCAATGGAACGGACAGTCTT[G/T]GAAAAGTTGTCAGCCTCGGGACAGGTACAAATACACACACAGACTCGGTT
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa19141
Status:
Allele not cryopreserved
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
G > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000025629 Essential Splice Site 1000 1373 9 15
ENSDART00000103213 Essential Splice Site None 916 10 16
ENSDART00000130112 Essential Splice Site 1007 1380 11 17
ENSDART00000146708 Essential Splice Site 1008 1381 9 15
Genomic Location (Zv9):
Chromosome 16 (position 25788052)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 23633727
GRCz11 16 23548759
KASP Assay ID:
2260-9632.1 (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTGCACTGTAATTAAAGAAGTGCTGTAATTGTTCTTGTCTGATGTCTCTA[G/T]GAAACCGCTGTGTTAAAGGAGAGGAGCTCAGTCTTCGTGGGGACACTGTA
Associated Phenotype:
Not determined