Busch Lab

ZMP

zgc:158654

Ensembl ID:
ENSDARG00000012338
ZFIN ID:
ZDB-GENE-070209-232
Description:
hypothetical protein LOC100009639 [Source:RefSeq peptide;Acc:NP_001076477]
Human Orthologue:
C16orf45
Human Description:
chromosome 16 open reading frame 45 [Source:HGNC Symbol;Acc:19213]
Mouse Orthologue:
2900011O08Rik
Mouse Description:
RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

Alleles

There are 3 alleles of this gene:

Allele Name Consequence Status Availability
sa40670 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa40671 Nonsense Mutation detected in F1 DNA Not yet available
sa33843 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

Allele Name:
sa40670
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
G > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054934 Essential Splice Site 26 192 1 6
Genomic Location (Zv9):
Chromosome 6 (position 19881302)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23652995
GRCz11 6 23752804
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTACGGATCCCTGGAATGCACGAAATGGAAAACAGATGTGGACCAAACAG[G/A]TATCCCTACACCTGGCTGTCATTGTAGCAAAACCTGTCAAAACGTATTGG
Long Flanking Sequence:
GTACTTTCAATTATAAAACTAGCCAATCTTATTCAGTTGTACTGTTATTTTAATGGCATTTATTCATGCCGAAACTTTGCACAGTTGTTAATTTGACCGCTGGTTTTGTAAATATTGTGATTTGATTTTGTAAATACCTATGCTAAATAAATGTTTTCATTGTATTATTATAAACTAAAATGTGTTGTTGTTGTTCTATAAATGTCCGCACGATGTCGCCAATGGGTCAGAAACTGCAGTTGAATCGCTGCCGGTGCGCAATGATGTCTAGATATCCCCTGCCGTAGCTATTTTCATCAGCAACGACAACCGCTGGATCATCATCCTTATTTTACCCTGCTCTCTTGCTAAGCATATCTCAGCTAAGTCAGGATTTGTGCATATATTCGGGTTTAGTTATTCATTCATTCCGTGGCGCGTGATGGATGAAAAACGCAGAGCCTCCTGTCAGTACGGATCCCTGGAATGCACGAAATGGAAAACAGATGTGGACCAAACAG[G/A]TATCCCTACACCTGGCTGTCATTGTAGCAAAACCTGTCAAAACGTATTGGTGAAAGGTATAGTAGACTACCAAACACTTGCGTTCTCTTTTTTATTAAAGGTTTGAGTAGGTTTAACGCCACAGGTGGAACTTCTGCTCTTGTGGAGATTGAGTTCAGGTAGATGAGGAGGTTGCTGTCGAGATCTGACAAGAGCTGAGTCTCTAGTTTTACCATTAGAAACTTAAACGCTTTACATTAAGATATTATTCCAGGGCCATGTTTTCAATTTAAATTGACTGCATACTGTAAATGTTTGGAATTTGCTTTGAAAATGTTCTAAAAATATAGTTAAAAACAGTTAAAGGACATTTCTGGAAGTATTTAATTTCACAGTAAATATATTTTACTAGAATAAATGTTCTATAATAAAGTATTATTAAATATACTTTTAAACTATAACAATATAACATTTATTTATAATAATAATTATAATTATTTATAATAATAATTATTATTTAT
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa40671
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054934 Nonsense 48 192 2 6
Genomic Location (Zv9):
Chromosome 6 (position 19896335)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23668028
GRCz11 6 23767837
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TCAATGGCGGACTCTACTATCACAGTTGGTGACATTGAGGGTGAACTCTG[T/A]AAGATTGAACGGATAAGAGACATTTTGATAAGGAGGGAATCTGAACTCCG
Long Flanking Sequence:
CCTCACAAGAAGATCGCCAGTAGGCATTTCTCTGTGTAGTTTGCATGTCCTCCCTGTATTTGTGTCCAAAGACACGCGCTATAGGTGAATTTAATAAACTAAATTGGCCTTAGTGTATGAGTGTGTGTGAATGAGTGTGTATGGTTGTTTCCCAGTACTGGGTTGTGGCTGAAAGGACATCTGCTGCATAAAACATATGCAGGAATAGTTGGTGTTTCATCCCGATGTGGCGACCTCTGAAATAGAGACTAACCTGAAGGGAAATTATTGAATAAATGAATTTTTGAAAATTTCTCCATAAGCACTGGTCATCTTAGGAGAAAGTATATTTTACTAAATCATTTATTTTCTAGGATGCAATTTAAGCTTAATTTATCTCCTCCTGGTCATGATCGGTGTGGTTTCAGTCCAGATCGTCTTGTTTTTCTGTTTTCAGATGCGGATGTGGTATCAATGGCGGACTCTACTATCACAGTTGGTGACATTGAGGGTGAACTCTG[T/A]AAGATTGAACGGATAAGAGACATTTTGATAAGGAGGGAATCTGAACTCCGATACATGTGAGTAAACTGTAAATAGTTGTATACTGTGCACTGTGAAAATGAAAAAACAAAACTGAAAATGTTTCATTGCTGTTACAAATGGTGTTACAAGAGATTAACTTAATGTTAAATGTTAGTTTCAGGGATTGTTTAGCTTTAATTAAGATTGCATCTGAAATAAAACAAACTATAAATAAGAGAGTTTGTTTAGAGAATGTTTAAAGAACTGTTTTCAAGTTATTCGTTTGGGAGCACTTTAAGCCTTCAATTGAGCAGCACAAGAGAAGGCACTCTGTTCTATCATGTTTGGATTGAGGCTGGTAAAGAATAAATGAATCAGCAAAGAATCAGCAAAACATAAGAAGGAACCAAATCATAAACAACTGTATTAGAACATGTTTAAATGCAAGGTTCAATTGAACTGGGAAAGTTCAAACTTTGCAAGTTTAATATGGTTAAAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa33843
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000054934 Nonsense 65 192 2 6
Genomic Location (Zv9):
Chromosome 6 (position 19896384)
Other Location(s):
Assembly Chromosome Position
GRCz10 6 23668077
GRCz11 6 23767886
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAAGATTGAACGGATAAGAGACATTTTGATAAGGAGGGAATCTGAACTC[C/T]GATACATGTGAGTAAACTGTAAATAGTTGTATACTGTGCACTGTGAAAAT
Long Flanking Sequence:
CTCCCTGTATTTGTGTCCAAAGACACGCGCTATAGGTGAATTTAATAAACTAAATTGGCCTTAGTGTATGAGTGTGTGTGAATGAGTGTGTATGGTTGTTTCCCAGTACTGGGTTGTGGCTGAAAGGACATCTGCTGCATAAAACATATGCAGGAATAGTTGGTGTTTCATCCCGATGTGGCGACCTCTGAAATAGAGACTAACCTGAAGGGAAATTATTGAATAAATGAATTTTTGAAAATTTCTCCATAAGCACTGGTCATCTTAGGAGAAAGTATATTTTACTAAATCATTTATTTTCTAGGATGCAATTTAAGCTTAATTTATCTCCTCCTGGTCATGATCGGTGTGGTTTCAGTCCAGATCGTCTTGTTTTTCTGTTTTCAGATGCGGATGTGGTATCAATGGCGGACTCTACTATCACAGTTGGTGACATTGAGGGTGAACTCTGTAAGATTGAACGGATAAGAGACATTTTGATAAGGAGGGAATCTGAACTC[C/T]GATACATGTGAGTAAACTGTAAATAGTTGTATACTGTGCACTGTGAAAATGAAAAAACAAAACTGAAAATGTTTCATTGCTGTTACAAATGGTGTTACAAGAGATTAACTTAATGTTAAATGTTAGTTTCAGGGATTGTTTAGCTTTAATTAAGATTGCATCTGAAATAAAACAAACTATAAATAAGAGAGTTTGTTTAGAGAATGTTTAAAGAACTGTTTTCAAGTTATTCGTTTGGGAGCACTTTAAGCCTTCAATTGAGCAGCACAAGAGAAGGCACTCTGTTCTATCATGTTTGGATTGAGGCTGGTAAAGAATAAATGAATCAGCAAAGAATCAGCAAAACATAAGAAGGAACCAAATCATAAACAACTGTATTAGAACATGTTTAAATGCAAGGTTCAATTGAACTGGGAAAGTTCAAACTTTGCAAGTTTAATATGGTTAAAAACTCCTGAGGACACATTGGATGAATCTTCAAAGGTAACAGTGTACTTTAT
Associated Phenotype:
Not determined