Busch Lab

ZMP

cr855317.3

Ensembl ID:
ENSDARG00000012269
ZFIN ID:
ZDB-GENE-100921-11
Human Orthologue:
CLCN1
Human Description:
chloride channel 1, skeletal muscle [Source:HGNC Symbol;Acc:2019]
Mouse Orthologue:
Clcn1
Mouse Description:
chloride channel 1 Gene [Source:MGI Symbol;Acc:MGI:88417]

Alleles

There are 10 alleles of this gene:

Allele Name Consequence Status Availability
sa9118 Nonsense Mutation detected in F1 DNA Not yet available
sa22800 Essential Splice Site Available for shipment Available now
sa32083 Nonsense Available for shipment Available now
sa44848 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39093 Essential Splice Site Mutation detected in F1 DNA Not yet available
sa39092 Nonsense Mutation detected in F1 DNA Not yet available
sa13816 Nonsense Available for shipment Available now
sa9348 Nonsense Mutation detected in F1 DNA Not yet available

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28629
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
A > G
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 None None 817 None 24
ENSDART00000131328 Essential Splice Site 23 697 2 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19587098)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17617421
GRCz11 16 17525398
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TGGGGGGGCAATAATAATTTTCCTTATAGAAAACTGCAATCTGTCTCTTT[A/G]GCTGTATGGAGAATATCGGGAGCAGCTGGGTAATATTTCCAGACGGGAGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9118
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 177 817 5 24
ENSDART00000131328 Nonsense 252 697 6 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19567527)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17597850
GRCz11 16 17505827
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATCTGTGCWGCAGTGCTRAGCAGGGTCATGTCAATCTTCACYGGTGTGTA[T/A]GAGGTAAAAATCCCTGTGAGCTTGTTTGGTGTGTGTTGCAGAAGTGTGTG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa22800
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Essential Splice Site 205 817 6 24
ENSDART00000131328 Essential Splice Site 280 697 7 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19566611)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17596934
GRCz11 16 17504911
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GTAGGATGTGCTGTTGGGGTGGGCTGCTGTTTTGGGACTCCCCTTGGAGG[T/A]AAAAATTTCCATTTCTTTCTTTCCCCATTGATTTCATTTCCTCTTCTGTC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa32083
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 207 817 7 24
ENSDART00000131328 Nonsense 282 697 8 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19563074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17593397
GRCz11 16 17501374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTTTAATCTTTTTTTTTTTTATTCATGTTTTCTCTGTCTCTCAGGTGTGT[T/A]GTTCAGTATTGAGGTCACATCAACATACTTTGCTGTGAGGAATTACTGGA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa44848
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Essential Splice Site 337 817 10 24
ENSDART00000131328 Essential Splice Site 412 697 11 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19561905)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17592228
GRCz11 16 17500205
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
AGCATCCTTCACATTTCCTCCTGGTTTTGGACAGTTCATGGCTGGAGAGG[T/A]GTGTATTCTCTTGCATGTAGAAGTAAATCTTAAACAATATCTATAAAGAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39093
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
A > T
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 None 414 817 13 24
ENSDART00000131328 Essential Splice Site 488 697 None 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19556074)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17586397
GRCz11 16 17494374
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
GCATGATTGATAATTGATTGCAATAATATGATAAGATTTTTGAAACAAAC[A/T]GGAGCGGCATTCGGTCGTTTGGTGGGTGAGATCATGGCTACACTTTTCCC
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa39092
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 513 817 14 24
ENSDART00000131328 Nonsense 586 697 15 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19555656)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17585979
GRCz11 16 17493956
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
TTACAGCCTTCTCTTTATGACTCCATCATTCAGGTCAAAAAGCTGCCATA[T/A]CTTCCAGAGCTCGGCATCGGTCACATCAGGTACCATAAGCAGAGATATGG
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa13816
Status:
Available for shipment
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Order Allele From ZIRC
Order Allele From EZRC
Mutation:
C > T
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 543 817 15 24
ENSDART00000131328 Nonsense 616 697 16 17
ENSDART00000144994 None None 88 None 3
Genomic Location (Zv9):
Chromosome 16 (position 19555350)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17585673
GRCz11 16 17493650
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
ATATCTTTGTGGAGGACATCATGGTGAAGAAAATAAAGTTTCTGTCACCT[C/T]AGTCYACTTACAGAGAGCTRAAAGATCTCCTGGAGTCCACGTCTCTTAAA
Associated Phenotype:
Not determined

Mutation Details

Allele Name:
sa9348
Status:
Mutation detected in F1 DNA
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
Not yet available
Mutation:
T > A
Consequence:
Nonsense
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Nonsense 765 817 22 24
ENSDART00000131328 None None 697 None 17
ENSDART00000144994 Nonsense 50 88 2 3
Genomic Location (Zv9):
Chromosome 16 (position 19540267)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17570590
GRCz11 16 17478567
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
TTRTTTTAGACTCACACATTGTTCTCTCTACTGGGTCTCAGTCATGCATA[T/A]GTAACCAGTATTGGTAAACTGGTTGGGGTGGTCGCACTAAAGGAGGTAAG
Associated Phenotype:
Not determined

Mutation Details

This allele has been removed from public view.

Allele Name:
sa28628
Status:
Less stringent filtering
For more information about the meaning of this status and other statuses, please see our FAQs.
Availability:
n/a
Mutation:
T > A
Consequence:
Essential Splice Site
Transcripts:
Transcript ID Consequence Amino Acid Affected Amino Acid Total Exon Affected Exon Total
ENSDART00000089292 Essential Splice Site 780 817 22 24
ENSDART00000131328 None None 697 None 17
ENSDART00000144994 Essential Splice Site 65 88 2 3
Genomic Location (Zv9):
Chromosome 16 (position 19540220)
Other Location(s):
Assembly Chromosome Position
GRCz10 16 17570543
GRCz11 16 17478520
KASP Assay ID:
None (used for ordering genotyping assays)
KASP Sequence:
None
Flanking Sequence:
ATATGTAACCAGTATTGGTAAACTGGTTGGGGTGGTCGCACTAAAGGAGG[T/A]AAGGATTTAAAGATCGTCTCTCCCAATTTACCAGACAAAATATATGGCTA
Associated Phenotype:
Not determined